Description :
From Genome Similarity Track
Location :
Scaffold_359:6660- 7675
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_359-snap-gene-0.11HECT E3 ubiquitin ligase

Sequence
1015 bases(100 bases per row)
CGCCACGGCAGCTCATGGAGCATTTGAACATCACGTTCATTGGGGAACCAGCACTGGACGCCGGCGGCGTGCTGCGTGAATGGTTCGGCCTGGTCTGCAA
AGAGCTCTTCAGCGCCGAGCTCGGTCTCTTCTGCACGACCCACGCAGAAAACATGAGCTACTGGATCAACCCGACGCTGAGCAAGAAGCTCACAGACGAA
GAAGACTACCTCAAGTATTACACTTTTGCGGGACGGCTGTTTGGCAAAGCGATCTTGGAGGGACTGGTGTTTGAGGCCAACATGGCGCTGCCGCTGATTA
AACACTTTCTCAGCGTCCCCATCACATTCTCAGACCTCGAGTTCCTCGACGAAGAGCTCTACCGAAGCGCCGTGTGGATCCGAGACAACGACAACGTGGA
TAGCATCTGCGTGACGTTCAGTGTCCAGAACGCGGACGGCGAGGTTGTGGACCTCAAACCGAACGGGAGCGAGATCGATGTCACAGACGAGAACAAGATG
GAGTACCTGGCGCTCATGCTTCGCTACCGGATGCTCGGCTCGGTCTCGGACCAACTGGCGGCGATGCTCACGGGTCTCTACGAGATCGTCCCGAAGAGTA
TGCTTAGCGTGTTCGACTACCAAGAGCTCGACTTCTTCCTCTCGGGTCTGCCCGTGCTGAACGTCAAGGACTGGCAGCTGAACACGCGCACGCTGCACTA
CACGACGGAGGCAGACATCCCCGCTTTGGAACAGGAGATCCAGGTCGTACTCTGGTTCTGGGAGGCGGTTGAGGCGTTCACGGACGAGGAGCGCGCTCGC
CTGCTGCAGTTTGCGACCGGGTCGGCGCGCGTGCCCGTTGAGGGGTTCAAGGCGCTCACGAGTGCGAGCGGGTACGTTCACCCGTTCAGTTTGCAGCTGG
TGCCGCTGGGGACCCCGCCCCTGGGGATGTGTCCACGCGCGCACACGTGCTTCAATCGGATCGATCTGCCGGTGTACAAGACAAAAGAGGACCTCGTCAC
GTACTTGACTCTGGT