Description :
From Genome Similarity Track
Location :
Scaffold_297:666- 7595
Transcript NameFunction/comments
g8106.t1hypothetical protein
g8107.t1hypothetical protein

Sequence
6929 bases(100 bases per row)
CCGTCGCGAGACGAGGACGAGCCTATGGAGGCCAACGTTGTCTCCAACAACCTCGACGAGGTCCAAAGCCAGCAACTGGCCGCGATGGAAGAGGCGCCCC
GCGCCCAGCGTCCGATAGCACGGCCTCTGCTCCACTCGAGCCGCCGTGACTACGGCTTTGAGCCACGCGACCCCAACGAAGTGGCTCGCCTAGCGGCGTC
GCAACTGTTGAATGACTATGTCATCGGACCCGCGGCCCATTCCAACGAAGAGGTCGCTCAACGAGAAGACCTCCGCCAGAGGTTGCTGACGCCTCAGCTT
ACCACTCAACGCGAGTACCGTGAGCGCCTGCAGCTCCAAGCCCGGGGGGCGTCCGTGCCGCAAATGCGGACGTATCCAGTGGTCCTACTGGCTGGCGAAC
GCCAGGAGCAGGATGTCGCTCAATTCGAGCTCTGGGTGGAAGGGGCTCGTAAGCTCTCTTCCATTGTCGCGATGCAAGCTAGCTTCAAGAAGGACGACGT
CCTGTTAGAGCGTCGGCTCCGGTTCGCGTTCGCGAAGTTAAAGGCGAAACGCCAACTTCCTTCGGGCTTCCAGCCCCGCCCTGCGCGGGCTCCTCAACAT
GCTCTTCCGAGCTCTGCAGACCTTCCACAAGGTGGATCGTCGGCTGCAGCAGCCCAGGGTCAAAGCTTGAGCTCAGCTGTTGACCCCCTCGCTCCCGGAC
CTACTGCCGGGAAGCGGGTGGCGACCGACGCGCCGGTCGCGAGCCCCCAGGGCGCCGTCGATCGTTTCGATCAAAAGCGTCCACGACGTCAGGGCAGTCT
TGCCGGAGGGGTACCTCAAACTCCCATGAGTTCTGCGAGTGGGGGTACCCTCGCTACTTCACCAGATACTGGTATTGATTTTGGCGGCGACGCCGAGCCA
CAATCCGTTCCACATGGAAGTGGCGATTGCCCTGCTCATCGAGCAACGCCGGTGGCGGACGCTGAGTTGCACTGGGTGCATCGTTCGGAGCTTGAGGACG
CTTGGAACGCGATGGGATCGCTGCGCCGGGAGGTCGTACGTCTCCGTGAGACTCTCCATCAGGCCGAGAACGCCTATGATCGTCATAGCATGAGATTGAT
CAGCTCCGGGAGCGCGTCGACTGGTTCGAGGCCCCAGCTGCGCTGGCGAACCGGTCCTCCGACCTTGAGCGAGGTCTGGCGAGGCTGGAGGGTCAAGTCG
ACCTTCTGCTGCGACTTCAGCAGGGTTCTGTGGCTGTGCCACCTGTGCACGTCCCGGTGCCAGCGCCTCCGCGCTCACCCGCGCCGGGTCCCGGTACGGC
TTGAGCAAGCCCACATAAAACACCGGATGGGTGCGCATCTTCTTCGGAAGGTTGAGCGTATACGCTAGGCCCTTCTTGGCCACGACTTTGAAAGGTCCGA
TGAAGCGTGGGCGCAGCTTCGTCTTGAAGACCGCAGAAACTGCATGTGTAGGTAGGTTTTTTGCGTTTAATAAAACCAAGTCTCCGACTGCGTAACTTTC
AATGTTACCTCTGCCCCTGGCATCTGCGTTTTCCTTTTGTTGGTCTTGGCTCTCAGCCATAGCGTCACGTACGTGTCGAAGGACACTCAGACGCGTTGAC
AGAAACTCGTCAACCTGTTTACGAACAGTGAGAGGGCTGACATCAGCAAGCCGACCGGCTATCTCTCCCCCACCAAGCCCGGAACCACGGAGTGGTAGCG
TCAACGGGACGCGAGGGTGGGTGAGGCCATTCACGTAGAATGGGGTAAAGCCTGTGGAGGCATGAACAGCATTATTCAATGCGAACTCCACGAGTGGAAG
CATGGTGCTCCAACGCTTGGGCGTTTCGGCGCAAACGCTGCGGAGGACGTCCTCCACGACGCGATTAACGCGCTCGGTCTGACCATCGGTCTGTGGATGA
TCCGTTGTGGACATGTCCAATCGGGTGCCCAGCACCTTGAAGACGGACGACCAGAACTTACCCGTGAAACGGGGGTCTCTATCCGAGACGATCGACTCGG
GCAGCCCGTGCTGGCGGAAAACCCGGTCGATAAACAGCTTGGCTGTACCTTTACCATCAATGGTGTCCAGCACCGCCGCTAGATGAGCCATCTTGCTCAA
ACGGTCGACAAAGACCACGATGCCCGTGTTGCCATCCGAGTCCTTCGGAAGGCCGAACACAAAGTCCATACTCATGGACTCCCAACACCCAGAGGGTACA
GGCAAGCTTGCCAGCGGCGCGGCCGCATGCGGTGAGGGCTTCACCCGCTGACACGTCTCACACGTGCGCACATACGTGCTCGTCCACTTGTAAAGCTTGG
GCCACCAATAGGAGAGGCTCACAGAGCCATAGGTCTTTTCACGACCAAGGTGGCCACTAAGCGCAGTGTCGTGTGCCTCATAGAGGATACGATATTTCAG
ATCCTCATCGTGAGGGACCACAATACGTGGAGTATCCTCCGGATCGGTGCTGTAATACAGCAGGCCATCATCGAGCGAATATCGATGCAGCCTCGCGCGT
AAGCGCGCCGACAGTTTACAGTCCGAGTCTCCAAACTCCTTGCTCCCGAGAGCACGTAGCAGAGCGACACACATGTCGTCACGCGCATACGCAGCGCGGA
TCAAGTCCGTCACGGACGACGTCACAGTCGTGACATGAGATAACTCATAGTCGGGTCTGCGGGACAGCGCGTCCGCTAACCCGTTCTGCCTGCCAGGCTT
GTACTTCACCTCGAAGTTGTACTCCGCAAAGAAGGAGAGCCAGCGGGCCATCCTCTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCGTAGTGACGCATGA
TCAGTAAAGATGACAAATGGCTTAGAGCCTAGCAGGTGAACCCTGAATTTGACTAGAGCATACTTCATTGCAAGTAGCTCCTTGTCATGAACTGGATAGT
TCTTCTCTGCAGCTTTAAGCTGGCGAGACTCAAACGCAATTACGCGTTCACGCCCTTCGGTGTCTGCTTGCAGCAGTGCACAACCGATGGCAAAGTCCGA
TGCGTCACAGACGACACTAAACGGACGATCGGGGTCTGGCAACGCCAGGATCGGCGCGTGTAGGAGACTCTCCTTAACCGCCTCGAAGGCAACTTGATGC
TCGGTGCCCCAGGCCCACTCCACATCCTTCTTAAGGAGATTGGACAATGGCCGAGCCATATCAGCGTAGTTCTCGCTGTACTTATGCAAATAGTTGGCGA
GGCCAAGCCACTTGCGTAAGTCTTTTTGGTTCTTGGGAACCGGCCAGTCAACAATGGCTTTGACCTTAGAGGGATCCGCTCGAAGGCCGCGCTTCCCGAT
GAAGCACCCTAAGAAGGGGATCTCTTCAGCACCGAAGATGCATTTGGATGCGTTAGCGTACAGCTTATTAGTGCGCATGCACTCGAGCACCGCTCGCAAA
TGGTCTATGTGGTTGTCCACATCTGACTTCCCGTGCTCGGCACGACTGTGGACGAAAATGTCGTCGAAGTATGTCTGTGCATACGCCCGATGGGGCCGGA
AGAGCTGCGTCACTAGACGATTGAACGTCGCGGGCGCATTGGACAGCCCCTGGGGCATCACCAACCACTCCCAGAGCATCCCGCTCGGGGTGCTGACCGC
TGTCAGCGGAATGTCGCTCGCACGCATGAGCAACTGGTAATAACCATCGACTAAGTCGAGCGCACTGTATGCGGTGCATCCAACCATGTTGTTCTGGAGA
ACATCCTTCCTAGGAATAGGCGTCTGCGCCGGAATGGTGGCGGCATTGAGCTTATTGAAAGCGTGGACAATGCGCCACTTGCCGTTTGAGTTTCTGACAC
AGAATGTCGGCGTCGAGTGCGGAGACTTGCTCTCGCGCACCATGCCCGCCTCGTGTTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCCTTGG
CAAGGGCCACTGCCTTGTTACGCAGTATTTGGTTCCAGGGACCAGGTCAATCTCATGACGCACGCCTCGATCTGGAGGTAGGCCAGAAGGCGGATCGTTG
GAAACGACATCTTGGTATTCCTTAACCAAGGGATAGTATGGATCTGAAGGATCCTTCAGGATCGCCGATCCACTACGCGCACTAAGCGCCTGCTTCGTGC
CCTCCAGGACTGTTTCGTCCATAAGGGACGACGAGTTTAACTCCTCTTCAGGTCGTATAATAGCGACCTCGGCTAATTCGCCCGCCTTTAAGGCCTCGCC
GAACTCGGCAATTGACATTTCGTCCAGCTCTAGCAGAGCATCTGCGGCGGGAACAGCCTCAAGGCTGACGTCGCCAGCGACCTCGCCGGTCACTCCATTA
ACGAGTGTATATAGCTGTTCGCTATCCACCACCCCCGACACTTGCTGTGTCATAACAGACGCTTTGCGTCTCGCAGCTGCCACACGGCGTCGCTGCCGTC
TCCTCGCGGAGACCATACGCCTCGGGGAGGCCTGCATATTCACACCAAAGGTGTCCTCAGGTGTTTCCACCTCTTGTTGCTTCATCGGAGCGTCGACGTC
AAACTCGACATCCGGCGAGGAGCTGCATAGCTCGCAGTCCCCACCCAGTGGGTTATGTGCCACTCCACACGCATCGTTAGGGCTGGGCCCAGGATGCCTC
GGCTCGTGGCCGACCGCGCCATCGTTGGCACGCAGCGATTCTCCGCCATCGCGGCGCTCACCGCTCAGCGGATAACGTGCCGCTCCACGCGCATCATCAG
GGCTATGCCCACGATGCCTCGGCTTTCTGCCGACCATGCCATCAACGGCCTGCAGCGATGGCTCGTTATCACAACGAGTCCCGCTCAGCGGATTACGTGC
CGCTCCACGTACAGCCCCTTCGGGACTCTTGTCTACGACATCATGAGTGTCAACCAACTCCGACACGCCGATGTCCAGCACGTTGACCGTCTCGGTCCAG
TGCTCGCGCCAATAGCGCTTTTGCTTCCTAGCAGAGGTGGGTTCATGACTCGCCAAAGCTTCACCAGGAGGCAACCGCGTAGCGCCTAAGGTCTTAGACC
TCCAATCAATCCATGGCTCATGGCGTTCCAGCCATGCCATGCCCAGGATGAGATCATATCTCGAATCCAGTTCAAGGACCAGACAGCGTTCAACGCTATC
GAAGTCCAGAAACTTCACGCCAAGGTTCACAGGAACCTTGGGCACCGTAACGCGGGTTCCCGTCGCGAGACGGACAGTGATAATATCACTCGTACGCGCT
ACCAGCGCCTCGGCATACTGCCGACTTCCTTCCATCGTGGAGCGTCGAGCATAATTGCCCGACGCTCCCGAATCGATCAATATCGTCCACGGCTTATCAA
AGCCCTTCACGGTCGCTTCAACGACCAGCAAGCCCGGCTTGCATACACGTTCCGTGTTAAAGAGCACGGTGCTCTTCGGGGCTAAGCCCTGCTGACCTCC
TCGCTGAGGCTCAACAGAACTTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGAGCGTTGACGTTTCCCCGCCACGAACCAGGTTTCTGGTAAGAAG
CTGGGCTTCGGCTCGCCGGAGCCTGGCGCTGCTTACGCAGCGGGCACCCTGGTCGCAGGTGCTGGGTGCTCCCACACACGAAGCACCGGCGGATGCCGAT
GCGCTGCTCGGCAGCAAGAAGCTCAGCTTCTTCGTCTTCAGCATGGCTGAGATCCATCGGCTCGGGCCCACCCGAGGAGCCGGCGGCTCCGGATGAGTTC
GTCTGCGACGTTCCCCACCCGGCTCGGGCCGACTTAAAGTTGAACTCGGCGTTCAACGCCACGCTCACTGCCTCTTCAAAAGAGGTGGGGTGAACTCGGA
ATACTTCCGTTCTGGCCACGCCAGTGCGGAGGCCTTCCATGAAGATGGTCACCGTGACCGCCTCCGGAAGAGGGTCCGCAGCCATACCGGCAATAAGAGT
TCGTAACTCTTGGACGAAGTCCACCAACTCCTTCTTTCCTTGGCGGGTAGCCAGGAAGCGTGATCGCACGCGATAGGCCTGGTTAGGCGGCGAGAACACT
CGCGACAGCTGAAGCTTCAGCTGCTCCCAGGATGGGAACGCGCTGTCCACCGACGTGCCACACGTTAGGGCCCACTCCCGGGCCCGGCCACCCAGCTTGG
ACACGGCCAGCGCCACGCGTTGTTGCTCCGTCTGGAGTATGGCGGACGCCATGGCCATCTCGACCTCTCTAATCCAGAGCAGGAGATTCTCTCCTTCCTT
GCCCTCAAAGGTCTTCACGCTCACCATGAGCGGCTTAGCTCGTGGAGCTCCATCCGATGCCGGCTTGGGCGTTGTAGACGCTGTCACAGCCGTCATCTTC
TGTTGTAGATGTTCCAACAGAGCATTCTCATAACTCGAGAACGCCTCCAGACGCGCATTAATCGCGTCGGGGCCTTGCGAAGCAAGATGAGCCACACCTT
CCGGGCCCAACAAGGACATCAGCTTTTTAAGCCCGTCCTGTTGGTTTGGGGGTAAGTGGGCAAATTGCTCCATCCTCACAGAGGGACAGTCGTAAGACTC
AGGTGTAGGATTGACTACAAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTTGCGTCAGAGGAAGACGTAGACTCTCAGAGTCTTAGTTCGGTTGTAAA
CCTTGGTTCTATACCAGAACCAAGTACAGTCTGTAGATATGCGATCTACAGACTCCTAGAGTTATTAATACCTTAAATAAGGCTAATAGACACTAGACTT
CAAAACGTGAACTGATTTTTATTGTTGTTATTCGCGGCAGGGCCGCCAGTGGGGTAAATGTATAACACTCACTATCTACCATAGTGGAGCCTAGTAATAT
GCATGACGGGTGGCTGTGAGGCCACCAACCTAAGTCTCGTGTACACACACCAACTTGGGTGTCACACCATTTGTGTGAAACACACTATTCGTGTACGATA
CACTAACGGGTACGTGTAACCCCGTTACA