Description :
From Genome Similarity Track
Location :
Scaffold_1080:666- 5722
Transcript NameFunction/comments
g16488.t1hypothetical protein
g16489.t1hypothetical protein

Sequence
5056 bases(100 bases per row)
CCACGATCGTTTGATGCGACAGGATGGTTCGCGGAGTTCGTACAGTTGTACGCGGCATTCGAAGAGGAGTTTCGTCAAGCGTTCTGGGAGTCTACCCACA
AGCTACCGATCACCAAGGCCATGAAGTTGGCCAACCCTTTTCTGGCTAAGTTTTGGCTCGGGTGCAAGCAGCGTCGATCTCGAGCTGGTCCCCGGTGGCA
GACCATCCTCAAGCATTTATTGGCTGGGATGATCGCCGGACACTGCGATCTCGACCTGCTTCTGGATCCCTTCTTCCTTCATTTTCCGCGCCAAAACGAA
CGGTGCTTTTGGTACCCTGGTTTTGGAGCCACGCGGGCGCCCCCTGACTTGATCAACGCTCTTCCTACCGCAGATTCTGCCGACCCGTGGCGCAACCAAT
ATCGCACACAACTGAGCGATCATCCCGGGTCCCGCATCGCACGTCTAGACGGTAAGTTTCGGTCTGTCGTCGACTCGGAGTGAAGTCACCCTCTCCAAGG
TCTTGATAAGCTTCTGCAATACATTCTTTCTCCTCTCTTTCCCTCTTTATTGGGTCACCCGACCCCGATCGGCCTCTTCCTTCCCCGATCGCAAACTCAC
AATTCACAAATTACCCCTTCCTCTGATGTGCGGCCATCCCACACATCCTTCACTCTCCTCCTCCCCTACAGTGCCTGTTACTGCAGGGGGTCTTCCGCTT
CCCCTTCATGGGACTGCATCACCTCAAATCTGTTCCGGCTGGCCAGTCCTCGTTCAAAATCGCGCAACATAGCGCCGCAATTAAGGTCCGCCTCATCGAC
CCAAGTTGGATCGTCGTAACCCTTCCAGAACACCAGAAAATCTCGGTGGACCCGTCCATAGCGCGTCCGGCGGCCGGTTCTTACATCCGCGATCTTCTCC
ACTTCAAACTCGCCTTCGTCGAGTGGGGTCTCCCAGCTGTCTTCCGGCAGGAGGGCTTCATCGAAGACCAGGCGATCGCTCTCGGCCACAAGCAACGACG
TGTCAGGACGATCGGGAAGATCCTATACTCCGAGCCCGCGATCTCAAGACGTGCGGCGTGATCGCCAATCATCTCAGCGACACGAAAAGGTCCATGCCAC
AGGTGTGCAAGCTTTCGTGCATACCCCTCCTTAACTCGGTCGAGGTGCAGCCATACCTGAGCGCCTACCGCGATGTTGTGGGGCCGCAGATCTTCGTTGT
GTCGGTTGGCTCTGCCTCTGATCGCCTCGCGCAGTCGCTCGCGAACCTGTTCCCGCGCTCGCTGGTAGTGTTCCTGTACGTGGTACCTCCATCGACGGGG
CTTCTGATCGCGTCGGCGTGTGCTTCCTAACGGTAGCGCCGCCTCCAGTGTCGATCGCGGGTCCCACCCGTGGGCCAGGTAGAATGGCGTGTCGCCACGA
ACTCGATCTTGGGCCGTATTCAGAGCGAACGCGATTCGCTCCGCGTACTCGTCCCAGTCTCTCTGGTTCACGTCTGACACGTACATCTTCAGCGATCGCG
TCAGAGTCTGCACCATTCGTTCGGCAGTTCCATTGGCTTGCGGCCGGTACGCCATTGTAGCTCTCTGTTTCTGACCCACTATCCGGCTAAAAGCACGGAA
GAAATCTGTCATAAAACCGGGCTCTCGATCATGGCGGATGACCTCACTCGCGCCGAAACGTCGAAAGACGCATTCTTCGTAATTCTCGGCGATCGTTTGG
GCAGTGCGAGAGGCGCTAGCCTTCGCGATCACGTATCCGGTGAAAAGGTCAACCCAGATTAACAGCTCTGTGTTTCCTTTGTACGACTTCGGTAGAGATG
GAATATGGTCCATGGCGATCATTTGGAATGGGTACGTAGCTTGTACATTCCCTGGCGATTCTCCCTGAATGAGGGGGCGCCCTTTCCCCGTTTCACAATC
CACACATTCTCCCACGAACCGCTGAACACTCCTGAACAGCCCTCTCCAGTGGAAGTGCGCCTTGACACGCTGGTAAGTCCTCCCGATCCCTTGGTGCCCG
CTTTCCAGGCTGGCGTGGTAATGATGCAGAACGTCTTGTTGTAGCGTCTCCGGGATGACCAGCCGTGCGAGGGAGTCTCGGTCCTCGTCCGATTGCGGTT
TTGTCGGGCAGTACAGCAGAAGGCCGCTCTTGTCCAGCTCGTAATCGCAAGCGGTCTTGGCGCAGGACTTAGCGTCGCTCGGCGACAGGTCGGTCACTTC
GCTCCGCAGGTACGATTTCATGTTCGCAATCCACTGCTCTTCGTCTTGGGCTTGCGTGATCCGTTCACTTCTGATGCGTTGCACGATCGCTTGCAGAACT
TCCGGCATTCGTCTCGACCGTCGTGCCGATCGCGTCACCGCTGATACACGAGCTACAGCGTTATTATCCCTCGGCTTCAGGAGCTCGTCCAGCCGATTGA
GTGTGATCAGGTCCTGTCGATCAACGTACGAGGTAACTACTGTTCCATCGCCCCGTTGAAGAGCTTCGCTAGCTAACTTGTCTGCGCTCTGGTTCCAATC
TCGTTTCATATGTAAGAACTCGTGTCTTGGCCACGATCGGAGCCGATCCATCGCTTTCTCGCGCAATAACAACAGGCCAGGGGCCTTGCATGCGATCTCA
CCACGCATTTGCCGGATCACTAAATTGGAGTCACCACAGATCACGACCCGCCCCCTGTCCATAGTGGACAGGAGACCGAAACACAACAGCAGTCCGCGGT
ATTCAGCTTCGTTCACCGTCAGATCAGGCATGTACTCCGATGCGGCCGTGACGATCGTCCATCCCGGCAGCTTCCACACGATCGCGCTATAAGCGCCACC
ACCGCGTTTGACACGCGCTGATCCGTCGAAACTCGCGACCAGCAAGGTTTCATCCGCTTCGACCGTAGGGGGTGGCATGGTGATCGTCAGCCGGGGCTGC
TTCACTGGGGCAATCGCGATCAACGCCTCGTCTACTTCTGCGCGAGGTGTGATGCTTGCTGCGATCGCTCCCAGAATCTCATCCTCCCCTTTCGTGCACT
TCCTGATCTCTAACGTCCATTCTGACAACAAAGCTGCCCAATTACCTAGTCTCCCCTGGAAGCCAGCCGAGTTGACCAGCCACGCCAGCGTCGAATGTCT
GGACAGCACCAAGATCGATCTCGTCGTCAACAGAGTGTAATTCACGTCCAGCATCCGCAGGAGTGCCAAGACTTCTTTGTCGAGAATCTCGTAGTTGATA
TCGCTGGGCTTCAGAGTACGACTGGTGAAGGTTACTGGCCAGTACACGCCATCATGCTCTTGTACGAGTGCCGCGGAGATCGCCCACTGGCTCGCGTAGA
CTACGATCACCGGGGTGCGATCTGGATCGAAATGTTTCAGACACGATCTTGGCCTTCAACATCGTGAATGCGATCTTCGCTCGGGCCCAGCGGTCAGCAT
CTTCTGCTCGCGTGACAACGCCCCCAGCTACTTGTTCGCTGGGGATGGACCTGTTCTGTTGACCTATCTCGTGGAAGTCCGCTTCGCGCAGCTCGTATAA
GATAGCGGCATAGACCGCGAAGTCTTCGATGAAACGACTGTAGTAGTTCAAACTTCCAAGGAAGGACTGCATCGATCGCAGTGTCTGCGGAAAGGGAAGG
TTGCCTAACATCTCAAGATCTTTCGGGTGGGCTTCCAAACCGTCGACGGACACTTGGTGTCCCAAGTAGTCCACTTTTCGTCGGCCCCAGAAACTTTTGA
CCACACTGATGGACAAATTCCACCGTTCGCAAGCGTCGAGCAATGCTTCAACCTTCTTACACAGCATGTCCCATGTGACCGCAGTCACCAGAATATCATC
GATGTACGATCGCCTTCCCAACACTGACGGTCTCGGTTTTGGTTCTGGCTCGCCTGAATCGAACACGTCGATCGATTCCGACGGATCGTGGCCGGCGCAG
ATTCGGAGATGTCCATACAGCGTGTTATCAATCAATCGCTGGTAGATCTGTGGCGCATTCTTCAACCCGAAAGGCATACGCGTCCACTCGAACAACCCGA
ACGGTGTGATGAACGCAGAGATCTTTCGTGCGCGTTCTGTCATGGAGACTACCCAGAAGCCACTTGCCATATCGAGTGAGCAATACCAGAGCACTTTGTC
CAAGTCTTCCAAGAGATCGCTAATCAGCGGCATGGGATACACCATCAGTCTCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACG
CCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTCGACGGCGTGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCT
TCTCACGGAACTGTGGAGCGACTTTCCGGACGCGTTGTGCAGCAGGAGCCGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCGGCTGGTGGTAA
CGCGTTTCCTTTCCCGATCAGGAGATGTTTCCGCCTCCAAACTATCTGTCGCAGCCGATCGATTTCTTCCGGGGTGTTCGACTCTGGATCGCCCACCTGG
ATATCTTCGATCGTAACTTCATCGGTGGCAGTCACTACTTCTGGTAGAATTGCCATATGTCTTTCCACATCTTCCGCGAACAGGTCGCCACCTTCGTGGT
AACATACTTCTTCGTCATCCAGCGGTTCCGGATAAACGATCGGAGGCGTTTCGGCCCGGGGCACAGACTCCTTCTGGTCAGCAGTCATCTCGCCTCGTGT
TGCCTACTCAATCGGTGGAGATTCTCTCGCGTCCTGATCGCTGGTATCAACTTCCTGATCCCTCGAAGATCCCTCAGGTTCTGGTTTCACCTCGGCGGGT
TGAGGCACGGTTAGTTGTGCGACGACCGATCTCGAGGTTCCGCGGTCACGACGCAAGATTTTCATCGGTGTGTCGTACTGAGGTCGATCTACCATGGGTC
CGGCAGGAGCGAGTTCGCGTTCTTCTACCTCCGCACAGTCTGTAGTGGACTGGAAAGCCAGATTCTGCCACTCGGCATACCTGCGCGATCCAAGTAACAC
GAAACCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCAAATGCCAACGTGGGTAT