Description :
From Genome Similarity Track
Location :
Scaffold_161:666- 1904
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_161-fgenesh-gene-0.0Glutathione S-transferase

Sequence
1238 bases(100 bases per row)
TTCCCTAGCATCAAACTCACCGACTTCGACCGTGCTGGTCGCTCCGAGGCTGCACGCCTTGCTTTCTACATTGGCGGTGTACCCTTCATCGACACTCGCG
TCACTGAGGAGAAGTCTGCTGCGCTCGAGCCATCGAGTGCAATACGCCAAGTGCCGCAACTGGACGTGGACGGACAGCGAATTATGCAACCCCAGGCCAT
CCTGCGTTTCGCCGGGCGACTCGGAGGGCTCTATCCAGTCACCTCACCCTTCGCTTCACTGAAAGTGGACGAGATCATCCACGGGTTGGGTGAAATGCAC
GCCAAAGTCGCTCCGTATCTGGACGAAGCAGACGCGATCAACAAGACTGCCATGCGCGAAGAGCTAGCGACAGTTACTCTCCCACACTATGCTAGCAAGC
TCGAAGCGCGACTTGAAGCAATGCTCGAGATACCCGCCTTCCAATCCGACACCATTCTCCTCCACCACGTCGCGATCTTCGAATGGGTCGAGTCGGTCCG
TACCGGTCGAATGGGTGACATCCCAGTCACGCTCCTCAACGAGTTCAAGCTGATCAACTCTATTCACGACAAGGTTGCGGCTCATCCGAAGGTGCAGGAA
TGGTACAAGCTCCCTCACAACCCGACCCCCAAGCTCAAGCTCTCGTACTTCCCTGCAGTCGGCCGCGGCGAGCCGATCCGCCTCGCGCTCTTCATCGCCG
GCATCGAGTTCGAGGACCATCACGTGCCGTTCAACCAGTGGCTCACCATCAAACCGACGACGCCGTTCGGCAACGTCCCGGTGCTGACAGTCGACGGCAA
CGAGACCGCGCAGTCGCTCGCCATCCTGCGCTACGTCGGGTCCATCACAGGATTCTACCCGACGGCGGCTCCACTGCTGGCGATGCGCATCGACGAACTC
TTTGCAGCGATCGACGAGCTGTACAATGCGCCGAATTACACGGCCATCTACCGAGCGTCCGACCCTGCAACCAAGGAGGAGCTGGGGCGAATAGTGGCCG
GCTCGCTGTTCATCAGCACTTTGGAGTTCTTAAACTCGAGAGTCGCAGAGTGGGGCGGGCCACACGCGATCGGATCGACGTTCACCGTTGCCGACTTGGC
TATCTACGTGCTGATCAGCATCTTGGGCAGTGGCCGCATCCCAGGTACCCCCACAGCAATTGCAGAGCCGTACGAACACTTGAAGCGAGTCCAGCAACTC
GTTCACGAGCACCCCAAGGTTGTCGAGTGGAACGCCGC