Description :
From Genome Similarity Track
Location :
Scaffold_10:66599- 72208
Transcript NameFunction/comments
Phypa_INRA-310PPTG_06600hypothetical protein

Sequence
5609 bases(100 bases per row)
TGTAGTGGCGGAAAGGCACTTCATGACGTGAGCAGATGCATCGCACACGACTAGCAAGGTCTCGTATGCGATCAGCAGGTAACGGACGACAGTTGGAAGT
ACGGGACAAGGATGAGATCATTTGACCTCACTATATTACATACATTAGGAAGCACGAGATAAGCTGAAACCACTGTGGCAGAGGCTGCAGTGGATGCATT
GAATACCAGAATTCATTTTAACTCCAAGATAACGAGTCGAATTCTCAAGCAACGCATTTAGGGTCGAAAGACACTACAAAGTTAACTTTATCTGTGGACA
CCGATCCAAGTGCCGGGCCCCATGAGTCGGCCCCAGCAGAAACGAAGCCGAGTGAACACGGCTGGTGAAGATGGCGAAGCGACGACACAAGCTACGACGA
AGCTGTGGACAGCGATGGAACCGCCTGAGATCATCTGTTTTTTGCACGAGGCTCTGGTCAAGTGGAGACGCGAGCGAGAGCTGTACGAAGCTGCGGTTCA
TTCCCGCTGCCAGGAATCAGGTGAGACTCTAGCGACCGTAATGATCCCGGCGATCAAAGCAATTAACAGACGTCGGCTAAAGACATTTAGTGAACTCGAG
TTGAAGGTTCATGTAGACGACATGGCCAACGAGAAGCTGGTCACGGCTATTAACCAGATCGTAGGCAGCATGATGAACGATCAGATACCAAATGTGGACG
TCATAATGAGTCAACATTTGAAGATGGATTTGAAGCAGAAAGATGTCAAAGCTCGAGTGCTAAATTACTTTGATCGTTTTGATGAGCTCATCGAGGAATA
CGGACTCAGTATCGCATTGGATGGTAATGACAAGTTGAAGTGCAAACTACTCACGGATAATTTTGCACCCGCCAACGCTGAAAGAACAAGTACAGCGCTA
CCAGGACCTTGACCCAACCGTGACGACAAGTGTGACGCGGTTATTTGACGTAGTTAAGGCAGAAGCGCTCAAAAATCAACAGTCGTTCGATCTCTATCTG
TCAAATAAGGATAGAAGCCAGGCCAAATCGACAGCTCGGGTGACACACCGTGAGAGCAACACATCTCAAAGAAGTAGTCGATCAACTCCTGCACGTGATG
AACGTCGAGATGAGCGACCGTCATTCTGAAAACGTGATGGCGTTCCAGCACAAGGGTGTTTGCATTGCAAAGGGTCACATTGGGTTAATGATTGCCCAAC
CGCGACTGAAGAGCAGAAGAAGACTGCACGAAGACTCTTTATGGAGAAACGTAAAGAAGGTGAGACTGCGAAGATGAAACGATTAATCAGCGAAAGTGGA
CAGATCGAGCCAAAGCATGTAGCATTCAACCAGGCAGTAACGATGCCATATCATACCGACAATGGTACGAAGTACAACGTCGTTCCTCGACGTATAGTTG
AAGCGATCCAACAAGTGTGTTGCAATGTGAAAACGCAGAGGCTCTCGACCCCGATTGAAGGCAAAGCGATTGGAGGCGCAATTATCATATGCAACGAGTC
AATTAGACTGGACCTGTAGCTGCTTACGTTGGCGGAAAAGTGAGGATGCGTGATGTAACATGCATAATCACGGAGACTGACGAAGATGAATTTCTTTTGG
GAAGTTTAGCTCTGAAGACTCTAGGGATTGATGTTGATGATCAACTTGCAGCATTGGCAAATAAAGAAGTGGTGGATTATGATCCTTTTGAGTAAATGGT
CCCTTTGAGCTTTGATCCGCCTGACAAGAAACGAATTATTGCCCGCCTTTGTGAACTGATTAACGAGGCTGTGGCAAACGGGTTTCCAGCAGAAAGAAAG
CGGGATCTGTTGGAGGTTGCTACGCGATATGATATTTGGCGGCTTACTATCGGCAATGACCCGCCGTCAAAAATTGAACCGTTCGAGATACAGTATAAAG
AAGGAACGCAGCCTATTCGATGCAAACCAAGGACGTATGCTCCACATGAACGTGAGTGGATGAAGCAATTTAACGAGTTGCTGGTGGAGAAAGGCTGGGT
ATCCCGGAATGAAGCCAGTAGATGGGCAAGTCCTGCGCGACCGGTTAAAAAGCCTGGAAAAGCACATGAACTTCGACAAGCAGTTGATTTTCGACGTGTC
AATTCTCGTGTTATACCATTAGCTGGTTCGATGCCGAGTCTTAGTACCCGACTGCAGCACGTCAAGCACAAAAAAACACAAGCAAACAGTGGACTTCATC
AAGCTTTTGGCAAATGGCACTCGCGCTAACTAGCCAAGAATCCCAGTCGTACATAACGGATGATGATATTTTCACACCGACTCGACTCCAACAAGGATCG
GTTGATTCGTCGATTCATTTTCAGCGGTCGGTTGAGAAGATTCTCCGCGAAAAAAAAAAAAAAGCTTCTGCACATGTCCTAGCATGGGTGGACGATTTGC
TGATCTACGGTAATACCATTGATGAATTTCTCGAGGTACTCGATCGAGTATACAGTACTCTAGCTGAGTATGGTCTGTATTTGGGTCTCGACAAAGTGTG
CCTGTATACCCAGAATGCGAAATGGTGTGGTCGTATTATTACCAGCGATGGTGTAGCCTACGATCCTGCCATGATACAAACTCTGATTGATATGCCCGAA
CCGACAACGGCTGCCGAGCTGCAACAGTTTGTATGTGCGGCAGGATGGATGCGTAATTCGTTAGTTGACTTCGCTCGCACGGTGGCATCCTTGCAGAATC
GACTTCAAGAGATACTAGTAATTACGAAACGAACGAAACAAGTTGCAGCCCGATTGTACATCACTCTCACCGAAGAAGAACGCGCGAGTTTTGCCCAAGC
AAAGCTACTTCTCGCTAATTCGGCCACGTTGGTGACCCCCGATGACCAAGATGAGATCTGTTTGATGACTGACGCTAGCGACCTTGGATGGAGCATTATC
ATCACTGCCGTGCAGGATTGGAATCCGTCGACATTACTGAGCAACATCACACGCTAGTACACTGCATGAGTGGGACGTTCACTGGAGCTTCTCAACACTG
GAGTGTATCAGAGAAAGAAGCGTACCCGATCATTAAGGCAGCAACTGATTTGGATTACATGTTGATACGTACAAAATGATTTCGTTTGTACTCCGATCAT
CGGAATCTTATTTTCCTGTTTGCACCAGGCGATGGAATTAAAAAGCATGTTCGCGGCAAATTACAACGGTGGGGTCTCAAACTCAATGAGCTTCGATACA
CCATTGAACACATCAGCGGTGAAGAAAACGTCTGGGCCGACATGGCCTCACGCTGGGCGTGTACCAGCGTAGTAGATACGCAGATGTCGATGAAACGATG
GACAGGAGAAGCTGTACAAGGGATTTCTCAGCTTCGGCCGCTTGGTCCCGACTCTGCCTGGCCAAATACTGATGATATTCACATAGCCCAAAAAGAAACG
AAGAGTTCACGGCCAACCTGCTTAGAAGAGGATACGGATGGTGGATGGCGAGATGATATGAACCGACTATGGATCCCGCCTGATGCGGAAGCACTTTTGA
TTCGGCTGATGGTGATCGCCCATTGCGGAACAATGGGCCATCGAGGGGTGAAGGTGATGATCAACCACCTCAAAAAGCACTTCAAAATCGAGAACTTGGA
ACAATATGCGCGCGAATTTTGCACAAGTTGCCTGCTGTGTTGCCACGTCAAGAGAGGGGGGGGGGGATATAATACCAAGACCGTGGGGAGAAATGTATCG
CTCCAAGGAGAGAAATGAAGCGTTGCACATGGGTTATCTCTACATAGGCGAGTACAACAACAACAAAACCTACCTTCTAGTGATGAAAGACGACTTTTCT
CACATCTGTGAGCTGATTGAGTGCAAGAACACGGATGCTGCGATTGCGGCTAAGGCCATTCTTGATTGGAGCAGCCGTTAGGGCATGCCGAAGATTCTAA
TCAGTGATATAGCAGCTCACTTTAAGAACCAACTACTGGAGGAACTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNN