Description :
From Genome Similarity Track
Location :
Scaffold_62:66581- 71921
Sequence
5340 bases(100 bases per row)
TGCATCCGTATAATTGTCGCACGCCTATTATCTCAATCGCTTTAGGGTGGGGTGCTGCTTAGTGAGAGTTGCCCAGATCTGGAGCAGAACATCTTACCTT
AAGGGGATACTTGATCCTAATCAAGAAAGACGTCTCGAGCCGCCTCGAAAGGTTACGCCTCCGTCCCCGTTGGGGCTTGACGCGGCACATCGCATCTGAA
TTCAAGTCTGAAGAATGGGGAATTACACCAAGCTCGAGCGCTATCATGGTTTGTCGTATCTATGACACTTCATGCCATTTAAGTCGAGCGCCTTCGCCGC
ACGGAAGACTCGTCTATGCCACAAGATGTACACATAGCCAGCGCCGGGAACCTCTTTCGACGGTCTGTTCGACGGTTTCGTGGATCAAAATAACATACTG
ACAAAGGGGGCGAAGGGCCACTCTTTCAGACCCTGAGGTCCGCCCTGGCTGATACGTTACTATACTACGATGAACCGCATTTGTTGCAAGTGCTACCTAT
CGAACTGTTCCCGGAATTGCTGTACCTCTTATTTTTTGACGGAATATCAAGGGTAAATCCAGGGCTGGGCGGAGCAGGTTTTGGCATTGTCCAACTCCAC
ATTCATACCCACGCCGCATGAGTCATATGGGTATCGAGCATGGCGTATGGGTTTTCAAATACCACTAAATATTGCTGAATATTGGGGATCGTGCACGGCG
TACGACAAGATAAGACCAGCGGTTATCTACCCCTGTATGTCATTGGGGACAGCACGCTAGTGCTCTCGCAACTTCGAACGCGTCGCCCCCTACGAGAGCC
ACACCTGGTGCGACTCTTTCAAGAGGCACGGACCGTAGCTGACTGTCTCTATGTTTACAGCTGGGGACATCACTATAGCACCTAAAACGAATGGCGGACG
ACTGGCTAATATCGCTATGGCCATAGGAGCTTCCATATAAGTGCTTGCCTTCTCAGACCAAGGTGTTATCACGGAGGCTATGGCCTTCTTGACAATGATG
TCAATAACTGAATGGAGGCCTTTCACACCTAATTCAACGAACTACAAGGCCCCGCGCTGACACCGTGGTACCTGATCATCTCGAGACAAGACTCTGCGCG
AAGGCTCTATTCCGTCCGAGATCTATTATTACCTAGTATATGAATTAGTAGTCGCTAAGAACCTTTGCTGCCTAGTGGAAGGATATAGCGGGTTGTACGC
GTACTTAAATATACATCACATTCCTTCCCTCTCCATAAATCTTAGAGTGCTGTCTCCGACTACGTGAAAATCATTTATATGCTTTTACCTTCCTAAGTTC
AAACAATATGTCCTTATGTTGACAGTCGACTCTGCAGATGTTCACGCGAGATTGTGTTATCACAACTGACATTTTACGCATACCTGTACTCTCGGCCGGA
TAATAGTACGTGGTCATGATCTCCGATAGCGGTTCCCTGATCGCGGTCCCTTCTTTGCAGTCCACTGAGCTTAGACTCTAGAACGTGGTCCAATTCGTGT
CGATCTACCTTCAGCTTCTTTCCAAGATCTGGGACGGTGCTGGTGAATAAGATTCTGCCCGTTGGGTCCTCCAAAGGTGAAGTCAATGTCAACGGCCATT
GTCCCACAACTCGTCAATCAAATACCGCTTCGTACTTATCTATGAGACAAGATTTGATCCTCCCGATTTCGATCTGCTTTACCACAATCTACCCCTGCAC
AATTAGCTGATCTGCATGATCTGGCTAGCCTGTGCACGTTTCAATCTTCACTCTCCGTACTGCCATCACTCCGTCAATCATTGTGTCTCCGACTTCCACA
CCTATTCGTGAACAATCACACTCGACCGCCAAAGTTGCGCGTCTCCACGCCCGGCGGTGGCATCACCCAGCTCGGCACCTTCAAGCACGACTACCTTTGG
AGTTGATGAGGGTCCGTCGCCTTCTTTACGGCAGCGTCCGTAGTTGGGGACACTGCTGTGAGTGAAGGTCCATCGTCCTCAGCTACGTCTTACTTCGTTG
GTGACACCTCAGCGAGTGAGTGTTTATCGCCTTCCGCTGCGCCTTCCGTCTTTAATGAGACACCTATGAGTGGAGATCTATCGCCATCGGTTGTACCGTC
CGTCTTTGGTGACACCGCTGAGAGTGAAGGTCTATCGTCTTCAGCTGTGCCTTCTGTCGTTGGTGACACCTCTGCGAGTGAATGTATATCGCTATCGGCT
ACGCCTTCAATCGCGCGTAAGACCATTGCGAATACAGGTTTGTATTTGCAATGGTCTCACGCGCGATTGCATCTGCGTCTTCGTCGTCTACTACATCGTC
CGACGCTTGTAATGCCACTGTGAATAAATGCCCGGTTTCGGTTCAGCGACCGCTGATGGCGATCAGCAACTTGAACCCCGGCTCCATCGGAGCGATTCCG
TTGCCGATCTCCAGAGTCGAGCCGCCACCGATCGCTGATCAGGCATCTTTAGTTGACACGATTTCTGACCTGTATCAGCGGATCGTGTTCCAGCAAGACT
TTGTCGAGAGTTACCGCGATCTGGATCAAGCGATGAGGGAACAGACACGTCGAGGTGATCAGTTGGAGCAGGAGCTCCTTTCCCTTGATAAGTCGGCTTC
TCCGTTCGTGACCTTCGTTTAAGTCCACTGTAATCGTCTCTGCCGTGATCTCGAAGATGCACTCGTGGAGGCAGCCTTGCTTCAGGAGGTGATCGTCCAG
GGGCAGTGCCGGGAGCAACAGATCCATAATTTGAAATCGAAACTTCTGAAGACGATCCCATCGCTTCATGCTGCTCAGAAGCGTCACGATCGCGAGTTGG
CATTGCTGCGGCAACCCATGGATGAAGGGAATGCCCGAATGTATGCCGAGCCCACTCAAGAACTCCCAAGAAAGCTCCAAAAAAGCCAAGTACAAGAAAG
CCAAGTAAAAAGCTTTGTATTTGGGGGCCCAGAAGAAGAATCGCAATTTCCACAATGCTCTAGCGGGTTGGCGATGAAGCACGACCAGTATCGAGACGAT
TTGGATAGTATGATAGCCTATCGCGATTGCCCTATACTTTCCGATCGGGAAGAAGAAGTGGGTCGGCACCAGACCTAGATCTTGGATTTGGAAACCGAGC
GCGATAGAGCATTGCAAGATCGCGACACCCTTCAAGATAGTGTCACCCATTTCGCTACCAGCTTGGTCATGCCTCCTTCGTCCAGTCCTGGCTTGGTGGC
ATCACCACTCTTTGGGTCATCAGGCGTGAAGGATTCGGCGGCGCCCCCGACAACCCGCAGCAAATGTTCCAGAACTTCCGCTCCCGTTACGTCCCTTCTG
AGCAAGAATCACAAGAAATGTATGTCATGTCTTCTATTGCTTTTCCGCAGTCTTCAGCCAAGCCGAAACCCAAGACGTTCCGTTTTGACCGGGTCTGGTG
GTCCCAAGAGCAAAGGCAAACAGAGAGTTCAGACTTCTGCTGCGTCTAGCTTGGATGACGATGAATCGTCGGACGCGGGATCCCAAACTCTAACCGCACT
TTACAGATCGCGACCTTCTTACCGGCGTAGGGTACAGCTTGGTAGCCAGATACCTCCGTCCTACGCTTCTCCGGATCTAATCGTGGTTGACACCTCCAGC
CCCGCTCCGGTTTCCCCGCCTCCTCGATCACTGCCTCTCCCACGTCCGAGCCCAAGACTTCCAAGGTGGACTTGTTTGGTGAAGCTTCCAGCAGTTCGGA
CGGCGCGATCAGTGTCTCGAAAGAATCCTGAGTTCCCGTCCATACGTTGTTGGCTCCGGCCGAGTATGATGCTCTTCCCAAGACCAAGGTGCCCCGTGAT
CAGTGGCTACCCGAATATCGTAATCGCGTTCCAAAATCATTCGTTGGAGTATCACCTTGGTCCGCTCGCAGGGTGATCTGGATCAGCGTATCGGTCCTAA
AATTTGTGCCTCCATCTAGCACTACCCAAGTATTATCCCCTCCCGGCTTCTCTTAGGGTGTCACGACCTCCTCCAGTGTCTGAGTGGTACTCCCTCCTGA
TTTGCACGGCATAGATCGATACGCTTTACCGCCAAGAGCCTTGGACAACTCTGAAGACAAGGGTCGCGCCTGTGTCTTTCCAGCACACTGGATGGTTCAA
GCAGTTGCTGAATATGTAACTCACCTTCGAGGATCACTATATCCAGATCTTTTGGGAATCGACCCACACTTTACCGATTTCCTCAGTCGATAGAGTTCGT
GATCTGAAATTGGCTTCATAATGCGATGAGCGGAAGCAGCGGCGGTCGTGATCTGGCCCCCGCTGGAAAACAGATCTCCGATTCATACTCCAGTGTATGA
TAGAAGGACACTTTGTGTGACGGGGTCACACAGCACAATCACAGAGGAAGTTGGTTCCTTAACTAAGCTCTAGACCACGGTTGTCCAGGGGACCAAGTGT
GCTAGACGTGGTTAGTTCTAAACTGATTTATATTTATAAAGATCTTCTAGCATTCCTAACGAACAAGAATATACCTATCTTTTGTATCCTACTAATAACC
TCCTGATATAACCTTGAGCCGATAACACGCGTCAGTCGTTCATAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN