Description :
From Genome Similarity Track
Location :
Scaffold_513:6658- 9036
Transcript NameFunction/comments
Phyag_g6297conserved hypothetical protein

Sequence
2378 bases(100 bases per row)
TGCATGAAGTACGTGTGCGCTTGTTCCAGTACTTTTACCCACTTGAGCATCTCTTCGTGAGTCTTTGCCACCATCCGCGTCTGGTGTGTAGGCGAGCAAA
TCATAAACTCGTTCGGCTTGCCCACCTCCTTGCCGTGCAGGATTTCCAGAGACTTGTGTTTCAGCGGGATCGACCCACGCGGCTCGCGGTCGCCTTCACG
CTTGTAGTATCGGAGATATCCGTCCGGCTCGATGTTGCACCACCGCTCGCGAACGCCGCGCAGCGACATGTTGCCGAACGTGCCCTTTTCGTTCGAGTGA
GTTGGGTGCTTCCGTAGGATGCCGCTCTTCGTCGGCACTGAACTATCTTGGGGAATCTGGTTCGAGTTCGAGTCGTAAGACTGCGTCAATGAACCGACAg
acgcactgctgctgcttcggtgGCTGAGGTTTTGATCATGTCGCTCAGAACCTCTTTGCCCGCCAGACGGAGGTCTGCTAGCAGCCTGCGATGCCCAGCC
CCCGCCTATGGACGCCCTGCCGCCGCTCAATGACGCTCGGATACCACTAAGCGAAGCACGCGAACCGCCAGTAGATCTCCGGGGAACGTCCTGCATCGGC
GACGGACCGCCAACTGAAGGTCTCAGGTAAGGCTCCTTTGGCTTAGCCGACACGTTTAGCGTTCCACTTGTCAGCATCTGGAACTGGTCTTGCACCACCT
TCATTTCGTCCTTCAACTGCAATCGCCGATTGCTCAGTTCACTTTTCCTTGCTTCGTCCTTCTCACCTGCAGCCTTCGCGAGTTGAACAACGGTTTCGTG
CAACTGGGACTGAAGCTTTGTCAGCTTATTCTGCAGCCGCGATGACTCCGACACACGTTCGTGTGGGGCCTCATCAATGTTAACCGTATCGATCGACGAA
TCTGCGTGCTGTAACGCAACCTTCTTGCCCTCATCGATATCGAAGAACACCTGCAGTTCATTCTCCATTCGTcgcatctcgtccagcgccgactTCAAAT
CGTCCTTTAGGTCAGCTCGTCGTACCGACAAATTCTCAGCCTGTTGCTGGTCTCCACTGTTCGACGCCTTCGCAATTCCGGCCACAGTTTCACGCAGGTT
CTTCCTGAGCAACGCAATCTTGTTTTCCAAAAAGATCAGTTGGGGCGGACGCTCGCCGCTAATAAAGGCATCCTCGCGTTTGAcggccgccgctgccacA
TCCATCTGGTTCTGAAATTGGTGGATCTCCAATTCAACAAACTTCGcccgctcctcctccagtttGATATCTTCCTCCAAATGATCCTTTTGTGCTTTGA
TTTTCTCCAGAAGCCGTTCACGTGCGTCCTCAGCACGAGTATCAATCGAGCCTCTGTGCACCATAGATCCCAAAAATGCCGGTGAAAAGAACTTTATCTC
GTGCTGGTTCGGGTCCAAGTCAAGGTCTCCGtattcgtccagctccttctgcagaCTGTCTAGTGTCTCCTCAATTTTGACGCGAGCTGTTTGCAATTCG
TCGTTTTCGGCAATAATTTCAGtgacctccttctcgagctctGCTGTTCGTTGGACTAGCTCTGCAGTCCTTACAACCTCCGGCGATTCGATTTCACCTG
CCGCTTGCTTGTCCAACTGTTCAATCACCTCCTTGAGTGAAGCTGCCTCTTGGGTCAAGTTTTCGCGTTCTTTTTCGAGGGAttcttgatgctgctgctc
cccTTCAATTTGCGACTGCATGATCTCACATTTCTTTTCCATCTCGAGGCGCTTTAGGCGCATATGATGGTTCGTAGACGACCACACTTGCTTGTGAAGT
TCGCTCGACACCATTATCTGGAAGTACTCCACACGCAGCGAATTCTGCATCacacgtgcagcacgggCCTCCTTCACTTCTTCAGTCTCTTCGTGTGGAA
CATCTTCCTCGACTCGGCCCACGATACCTTTTTCGATATCGGCGAACTTGATGCGAACCGGGCGTATCATTCTTGCGAGCAATTCCAGCACTTCAGAATA
CGTATATCCGGTCAGTGAAATTCCAttcatcatcgtcacgcGCATGTTCACCGCAAGGCGCTTTTCAGGCTTCACACTCCAGTTATAAATCTCTGCAGGG
CTTGCCATTCCATTTGGTAGCTTGTAAATCTCCGCAATGTGGACCTGGAGGTCAGTGAACACCGTGCCCGGGATACCAGCAATTTGCTTCAGGTTTAGTC
CAAGCCGGCCAGGCCCAAATGTCACCTCGATTTCGTGTACCCATTTGTAGATGACACCGGTTTTCATGGGAGGGCGCAGCCACTGCGTATGTCCGTAAGG
TGATACATAGTATGTCTTGCCGTCGTTAGTTTTGCTCTGGCGAGTGGACCAGCCCTTAGGCAGCGCCAAAATCTCACC