Description :
From Genome Similarity Track
Location :
Scaffold_60:665760- 668418
Sequence
2658 bases(100 bases per row)
CGACGTTCTATTTTGGACGCCTTAAGCGGTACTTTGATCCGCAGTGGTTGCGGGCTCGCAGACCCACCTTGGCCCAGCTCCTCGAAGCGAGAGCCGACCA
CAGACGTCGACGAAGGCCTCGGAGCAGGCACCCAAGCCTTGGTCTGAACAGCAAGGTTGCGGTCAAGACTGTACGCTGGAGGGGCTCCGTACGAACGGAA
CCCGGAGCCATACGCCGAGTACGTTGAGTACGCCGGGTACGCACCATACGCGTACGTCGGGTAGTGCGTCGAAGGCGGCCCCGGACGTGGCAACAGACGA
TCCGTCGGATCATGCGGAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGATGCAGGCTCGCGAACTCACGCTACAACAGGTCCAG
GCGGGCCGCAAGACGAGCGAGATCGCCCTGATTCCCGGTCTGGGCGGGAGCATCACCGCCAGTCCTAAGGCCAAGTGCAATCTCAAGCACGAGGACGCGT
TGACGAAGGCGGTCAACCTAGGGTCCTACGTCGGACCAACAGGAGAAGCGCTCGGTCAAGAGTAGCGTCCGGGAGGCGCCGAGTACTCGTACTCGTACGA
GGACACCTCTGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGT
GAAGTGGAGGGGTTATGCCCACACCGAGAACTCGTGGGAGCCGATTGAACGACTCCTGATTGACTGCCCGAAAGGTGTCGCAATCTGGGAACAGAAGCGG
CGGCAGCTTCATAAGTAGTCCGGGGCTTCTTTCCCGAACGGGGTACGGACGTTGAAGACACTCCTTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCACG
CTTCAGGGTGTCCCTTGGCAGCATGCGCTTGCTGGAAAATTGAACACGAAGATCATGGTGGTCCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCC
CGTAACTCCGTGGGTGAGTACTTGAGAGACTCCACCCAAGCCCAGAACATGTCCCCACGAGAACGCCAGGTGGGGCATTTCTCGGGCAGAACCCAGATGT
ACCCCCAAAGAGGATAGAGACCACCCCGGTTCTCGGGCTTCTTACGACACGTAGTGAAGGCGTTAAGAGGGATGCGTGTGGCGCGAGAAGCGCGCACCGA
GCCGCCTCCAAGTTGTCAACAAACAACTGTTCCTTCTGGGCAAGAATACGTTCGTAAATGCCCCTAGAGGTGTGGCCGCCCACAAGGCCACGAGGAGCGA
CGAGAAGCTCCAGGAAGAGGTCAGCCCCAGAGCTCTCCTTGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCACCACCGA
GCCCCACGCGAACGCTGGGCAGCTTGTAAGTTCTCCTGCTTCTGGTCGAGGTCATTTAGTGATCTCTCGGGGCTCCAAAATAGCACCCTCCTCCTCATCC
TATTTCTCCTCCATCTCATCCCTCTTCACCCGAGGAGTCGAAGAGGCCCCGATGGGGGTACCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTCGAAGCC
ATACGCTTCTTAGAGGGCTTGGCGCCTTCGGCTTTCGCGGCCTTAGCACGAGCAAGTTCCTCGTCAAGCGAGAGACGGTTGCCAGGCTTACCCTCCTCGT
CGACACCAGCTTTGGGAGTGCCCTTAGCCTTGACGGCCGTTATCTCAGAGCGCACCGACGTCCTGGGACTTTGATCACCGTGATCACTAGCGAGCGACGG
CACGCTGTCGTCTTTGTGCTCGCTGGGCACTGGGATGTGCCCTCCCGTAGAGCCCACAGGAGCATCGTGCGTGCTTCCGGACTCGGCTTCGTCCTCACTG
GTGAGTCGAACTGACGTTCAGCGAACCGAGGGTTCGGACGGCTGTCTGGGGAGGCCGAGGGCGACGGACTGCGGCGCTTGCTCGTTCTCTTGGCCACAGC
CGCGTCACCCGTTGAGCCGATCTCTTCGGAGGCCACCTTAGTAGCCTCCTGGAGTGCCAAGCTTTTGCCGTGAGAATTAGTGCTCTTGGCTTGCGCCTTT
CCGGCAGCAGCCCTGGAGCGTGTCTTCGCACCGCTCTTCGCAGTGCCACGAGTCATGACATACAGTCACAGCGGAGACAAAGAAGAGGAGCGCACAGACT
GCTGCTCGAGGCTTTAACTGTGAAGTGAGCCTCAGCCGCGCTCGCGCTGCCAAGTCGATGTTTTTTTACTTTGAGAATGAATAAAATTTTGTGACGTACA
CTTCTTCATTCTGATTGGTCGGTAAACCGAGCCTAAGTGGTAACGGGGTACGTAGCCCTAAGTGTACCCCTAGTTACATGAAGTGTGACACGTCATACTT
CGGGATGTTTGGTACAAAGTACCAAGGTTGTCCGAGGCCAACCATTGGCGGATGACATTGCTTTTCTATAGGTGACTACTTGTTTGTATATTTAAATCAA
GCTTAGCCTACCTATAAATATACTCAGCTTAAACCCTCCCTTTAATTGGTCACCTCGCTCCCTTTAAGTAAAAAGAGACCTGTGGACTGCCGCTCACTGA
GAGTTTGTATAAGCTTACTCTCGGAAACCAACTTCCTCTACTGTGTGACCCCGTCACA