Description :
From Genome Similarity Track
Location :
Scaffold_698:6657- 10413
Sequence
3756 bases(100 bases per row)
CTACTACACCATATCACGATTAACGATATCCAAGTGGATCCAGGGGCGAACGAACCCGCGGAAGTGGATCGGTTACGTCAGAAGATCTGGGAAAGCCGAC
ATCTGCTGATTGGTAAAGGTAATGCATTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGTGAAACCGATCGCTCAAAGGGTGCG
GAAAGTGGCACCTCAGTTCCGAGAAAAATTATCGGATCTGATCAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCGACGTCCCCGTGGGCATCTCCG
GTGATAATCATCATCAAGAAGAACGGTGTGGATATACGTCTGTGCATTGATTACTGGCTAGTTAACGGCCTGACCCGATTGATGGTGTATCCAATGCCTC
TAATAAATGAGCTATTGGAGGATTTGGATAAAGTAATATGGTACTGTTCTCTTGACATGGCCAGTGGTTTCTGGGTAGTTACTATGACGGATCGAGCTCG
CACGATATCCGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGGATTGAAGAACGCACCCCAGATCTACCAACGCCTGATCGAT
AACTCCCTGTACGGATTCACCCGAATACCGGAACCCGAAAAGGGAGGATCCGGGGAAGATCATACGGAAGTGGATCCATTCGAAGCAGGAGAGCCAGGGG
ATCCTGCGACCCCGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCCGGCGGAATCGTGGGACCTGTTGTGCGAGAGAGTGACATCCCT
ACTGGAGGCGAGTACTAAGTGGAATCTCTCTATCAGCGTAGTAAAGCGCTATTGGGGGATGCGCAAGGTGGATTACTTCGGCCATCGAGTCTCCAAGGAG
GGACTGGGGGCGAATCCTAAGGACTTGTCTTCGTTGGCAGGCTTGTACTTCCCACAGTCGTTACGGGCGATGCAATCGTTCTTGGGCAGTTTGAACTACT
ACAGTCGGTTCATCGAGGATTACGCACTGTTTGCTGCGGTACTATACGAATTGAGAGAGGTAGAGTTTGCTGCGATGACCACTTCAGCTGTCCAGATCAA
AATCCAACAAGCTCTGGCCCTAGAGATGTCGGATTTACGAAGGGATCCAAGTAGTACGACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACCCCGG
GACCAAAGGAAAGAGGATCCAATCGGGATAGAGACGACGGATCAGAACTCGGAAAAGGTGGAACCTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGC
TAAGGAACAGGATCGCGACTACGCCCATCCTCCGTCATTTTGATCCGGAACGTCAACCTACGGTGATAGTTTATGCCAGTGATTGGGCAGTCTCAGCAGG
CTTGGTACAAGAACATGAAGGGATCGATCATCTAGTCACCTTCGTCAGCCGGACGCTAAAGCCAAATGAACTGAACTAGAAAGCGGTGGGGAAGGAGATA
CTCGCGCTCCTGCGCGTGTTGGATCTCAATTACAGCCTGCTGGTGGGAAGATCCATCCGAATCCTGACTCGACACTCTACGTTAGCTTGGCTGTTCAAGT
CGGCCGGGTTACAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACGCTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGG
AGTCTTGGCCGCGAGCATCACACCTCGAGCTAAAATGGATGAGGCGCTGGCAATGAAGCGGAGTATAACGGACTCCTTCTGGGTTTGGATTTACTAAAGG
GACAAGATCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTGATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTT
ACGGCAGAAAGTGATGATCCACCTGCGTGGTTGGTTGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGTTTGGCCAGTGCC
GCTTTACGGAATCAATGTGGTGTCGAAGTGGAGGGAGAAGCCGAACATCAGGATCTCGTTACGTTGAACCGACTGGACGAAGTGGTGGTAGTTGGATCCG
GGAAAAGGACCGTCCAGGTGATGGCAGTCACTAGGTCCAGAGGTAGGATTGGATCCAGTCCCCAGATCCTCGAGGAAACATTTGTGAAGAGAGTCCGCAT
TGGGCGGATCCTCAAAGCACAGGACGAGGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGGGGATGTACGAGACCTGAGTCGGGAAGACGCCAAA
TCCTACAGCATTATCGCTACGGATTACGCGGTGGATCTGAATGACTTGCTCTTCTATTGCTCCCCTACGAAGAGAGTCAACGAGGATCGGGATGGATTGA
TGAGACTGGTGATGCCGGAAACCTTACACCAGGATGTCCTACACCACTATCACGCTAGCTTGGAAGGCGGACATCAGGGTATTGGTCGAACCTACCAACG
GATCCGGGACTGTTTCCACTGGAGAGGACTATTCAAGAGCGTACAACGATATGTCGGTGAATGTGTGGATTGTTAGACAGGCAAGGGCAGGCCCACAATC
GAAGGGGAGTCACCTGATAATATCCAAGCGACTTACCCTTTCCAAATCATAGCCATGAATCATATCCCCTCGTGGCCCAAGTCGTTCAAAGGAAACACAG
AATTGTTGATTTGGGTGGACCTGTTTACCGGATACGTGATAGCCAAAGCTAGTGCGTCTAGAACTGCGCAAACCATTGCTGAATCATACGAGGAGTGTGC
TTTCCGAAGATTTGGAGCTAGCAAAATGATTAGACATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGTATCCTGGGGCAGCTA
CAGCGAGCAACCATGGCATATCGTCCCCAAGCTAACGGGCCGGCCGAGCGCATGGTGCAGACGATCACGAGAGCACTCAAGCTGTATGTCCAGGATTTGG
ATCAGAGGGATTGGGATGAGTACGCAGAACGACTCCCCTTCGCGATAAACACCGCCCAAGACAGGATCCGAGGTGACACCCCATCTTACTTGGTACATGG
GTGGGATCCCAAATCCACCCTAGAAGCGGCCATTCCAGTATGTAGCACCAAGAAGAGAAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAATAC
TACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAAGATCGAGCGGATCGACACAACGAAGACGCCCGTCCACATCAAATCCAAG
TGGGATCGCAGGTGCGGCTTTATTTAGATCGGGTGAAGGAAGGGTATGCCCGCAAATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCGAAAAAAT
AGGGGAACATGCGGTGAAGTTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACACGTATCCAAGCTGAAGTTGGTCAAGGAATATCCGGAC
CGGCCGCAAACCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTTGACGAAGTCCTCCTACCTGAAGATAGTTGGAATGTGGATCTCGAAGCCGACG
AGTTCGAAGTCGAGAAGATCACCGATATGAGGTCAGGGAAGCGAACTAGATGCGGACGGATCTACCGTGAATTTCTGGTGTATTGGCGTGGATATGACGT
ACCCAGTTGGGTAGACGAAGCAGATCTGAACTGTGGAGCATTACTCTATGATTCTG