Description :
From Genome Similarity Track
Location :
scaffold_18:66555- 68505
Sequence
1950 bases(100 bases per row)
AGGAACACTTTTACGTAATGACTTCCATCTTTGGTATCAAATGTTTGAAAAAAAGTTCCGATTCATGCTCCTTTCATTGATACATGTGTCGCTCTTCACA
CCACCTGTATCCAGTCCACCAACAGAGAATTAGGACCGAAAACTTGTGCCCCAGAAAATATCAAATCAGCTATCCATTAGCCTAGCTATAGCACCATTCG
ACTGGACATTACCCCGCATTCAATTCGTATGAGACCTTGATCCAAGAACGACGAGCAACAAAAATGATATTGCTACATCACAGATTTGAAGAGTATTCAC
GTTTTTAGGCTTACGGTTAGGGCTATGGTGTACAGAATGAGAGTATGAGATGTAGCCATTCTCGAATTCTGGTATCATATTTTATATAAAGAGGATACAa
ttggcgtgatacgagcaaatcttttgcacggaaaactAAAGCTGCTGCGTATTTGTGACAATTGCACAATTTTGTGTCATATTCCAATTAAGTGCACTTG
AACCCTATTAAACAGTATACTCTTGAATGGACATTATATCAGGACGCAGCTTCTCAAGGTTGAGGTGGCAATAAGATTGAAATTATGAAAGTAAATATCC
TGTTAAAATACAGAGCACTATTTTATATTCTTCTATGTCAAAATCGGAGGTTGAATGGCTGATGTACACGCCACCAACTCCGTGTAATCTTTACAGCGAA
ATTCTGTCTGAATGTAGCGAAGTATTTTTGGATGGACCGACATATTTGCATTTTCTTCAACTACATCTATTTTATACGGTTCAGACGAGAAAATGCGACT
ATTTTGCAGTCTCCAAAATTTAAGAAAGGGACTAAAGCCTACAAGTAGCAATCTCAGGACCTTGAATTGTTTGAGGATGGCTTTGTCTTGTCATGATGAA
ACGGTACTGATGACTCGGCAGTTTCATGTGACTAGCCAGATGAGCGAAGCAGTGAAACTTCATAGGTTTGTAACGAGAACGTGCGTAGACTTATGAAGAA
GTGATCAAGGTAATCTTAGAAAATACATCATATCTATCCTGTCCAAAGTCAAAGCTCTGTTTGCGCTTGACGGAACATCTCGAGGGATCTAAACATAGTG
TTGCGAGCAGTGTAACATCGAATTAATTCGATCAATACCGAAATCGCCATTTTGCATGGACGAGTCCGGTATCGAGAACACTTGCGAAGCACTGCAAGCG
AGGAGTAAAATGGCGATCCTCAAAGATCCTTGTAGTTTTTGCTGAATGTGGTGGTTAGAGACCGTCTTGTACGGGATACACTtgtcatttttttgtcatt
gATTTACGTCATGGTACTTCACCACGGTACTTTTGAGCTTTAACCTGAGTCCGAAGAGCAATTCTGTATTGTGTACATCTCTACTAGCAGGCACTACACT
CCCCCACCAAGACGTGAACTCCCGTTGAACATATCTCACACTAACTTGAAGAGCACCTTTAACGCTTGAAGTCAAATCCGTATGGTTCCTAACGAATTTT
AGTCAAAGTGTCATATACCACcctttcaaaattgacatCTTTACGGGCACGAATGGAAGAAAGCTAGCTGTATCTACCATGACTATGGGTGTACCAGCAA
GTTTGATGGAGCGTACGCTGGCCAAGAATGTCGACCAATGCTCTGTATTGAGATGTACAAAAGCTCGACTTTGACGCCGATGCTAGCACGCTCCTAAGTC
CGTGCTAACAACAATCCTGCTTATATTAATAAGCATACTGCCACGCAACTGGCCAAGGGTCTCACTTGGAATAAGGCTTGAATCAGCATCGTTATGTCAT
CGGTCTTTGGACAACCAGCTGTAAGCACGTCCAACCTGGTGATAAGCACCTAAAATAAAGTTTGCCATAATTTGCTGTGACAAGTGGATCTCAATCCAAA
AGAACTAGCCTTATCACCAATAAAGTTTGTTGAGGAAGGGATGATGAGGT