Description :
From Genome Similarity Track
Location :
Scaffold_351:6655- 8205
Sequence
1550 bases(100 bases per row)
GCCTTCTCAAAGTCGAGAAACATGGCATATGCCTCGTCGCCCTCCAGGGTACATTGATGCTGGAGGTCCTTAAGGAAGATGACATGGTCATGTATCCTCC
GCCCAGCCACAAAGCCAGTCTGGACCGGGTGAATGAGTAGGGGGATGATCGTGCGGAGTCTGTGAGTCAGCGCCCGAGAGAGCGCCTTGACCTCTACAGG
TATGAGGGAGATGGGTCGGTAATGGCCAGGGTTGTTACGTTCCCCACCCTTAAAAAGCAGCGTGACGGCTGATCGTCTTTGGGACCCTAACAGCACCCCT
CGCTCGAGCTGGTATGCAAAAACGATCGAGAGGATATGGCCAAAGGTATCACAGTCCAGCTGGAAAAAGGCTGGCGGGAAGCCATCCATGCCTGGCGCCT
TGTTGGGGGCCATTGTTTTTATTGCTGAGGCCAACTCGGCTGGAATAATGGGCTCTTCTAACTCAGAGCGTTGTTCCTCCGTCAGGCGTGTCTTCAGGCG
CCGCAAGAACTGTCTCCTAGCGGCGCGATTGGGGGGTGCGAAGTCTCCCTCGCACATGATGGAGGACCATCGCGTATGAAAAGCCTGGTGGATGTCCTGT
GGGTGAGAGGAAACCCGACCGTCGCCTGTGGTGACAGTGGCGATGGGGACCTTGTAGACAGTCTCCTGTGGTCGTCGGAAGAAGTGCGATGTCGATACCT
CAGAGTTGGATGTGTAGAAGTCGAAACTGACATCGTTTTGGTGCTGTCTCCACTCCAGCTTAATAGACTCCAGTTTGGTGCGTTCCACGACCAGTTGGTC
TGCTGTCAATTCACCACGAGCAGCCTGCGCCATAGCTGAGACCCAATCCTGCTCCGCCCGTTGGACGGTTAAGCCCTTGGAGGCGATATGATGGGCGTGG
TAGTGCTCGACGAAGTCTTTGGTGCGCTTCTTCCAGCCTGCCCAGACGACTCCGGGGTTGTGAGCATGTAGAAGGATAGGTACGAGAGCCCTGGCCTCTG
ATATGATCGCCGAAGTCACCTCGGGAATCTCCAGTATCCCTTTGGGAAGCTTCCAATAGCCCCGTCCAACTTGCACGTCTGTGGTCTGGAGCGTGACAGA
GTGGCACATGTGCTCAGCAATCTGCTCGGAACGAAAGTACTTTGCGTCCTTGTAGGTCGCACACATGGTGGGAGTATCGACAAATATGTAATCAATGCGG
TTGCGTCCATGGGGCGACGAGTATACCCGGTCGTGGGGGTGGTGGATGCGCCACGCATCTACGACCCGAAGGGATTGCAGCCAATCAGTGCACTCTGCGC
GGCCTCCGTGGTGGTTCGAGGCCTCGCCTTCATAGTCGAGGAGGCGGTCCATCGGAAGGTTGAAGTCACCCATGATAAAGTGCTTGGCATGCGGGGGGAA
GTCGCGAGGAAGAGATGAGAAGTAATCCTCACGAAGGCTATTGGGGATGGGGGCGTATACGTTGTGGAAGTACACCGGCGTATCCCCCCAGCGAGTGCTT
ACCACCATGTATTTGTCTGGGACATCCAGGTGGGACTCATGATACAGGTG