Description :
From Genome Similarity Track
Location :
Scaffold_262:6655- 7720
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_262-snap-gene-0.14HECT E3 ubiquitin ligase

Sequence
1065 bases(100 bases per row)
AAAGATTTCCCATAGGAGTTTGAGCCACTGCGACCCATGCATGGTGAAGTGCAGCAGCCCTTCGGATGATGCGCTGAGTAAAAGAACCACTGCGAGTTGA
TCCATCATTTTGCGCTCTTGCGCATCGATACGAGTCAGCGGTGAAACGGTTCGTGACGTACTAACGCTCGTGGGCCCATTCTGCTTTTTCTCATCGTACA
CAATGCGGACATGGATCGGAGACAGCGAACGGTTGTGGAACCGAAAGTGACCGAGAATGCCCTCGAAACTCTTGAGCGTCTTGTCGCTGAGCTCATCACT
GTCAGTAGCTCCAAAGTACCCACTACTCCGCTTTGTAGATCCAAGAGACAATGCTAGCAGGCGCAACGAGGCTGCAACCGAAGACAGTGTCGAAGAGGAT
GATGGCTCCGTGGCAGATAAGACCTTTGACGAACACTTTCCGAAGTGGAAAGGGAGATCCACACTTGCATCAGCCAACGCAGACGCATGTGCTGTCGCAA
GGGCTCGCTGGTTGTCCAATATACCATTCAGATACAGACGAATCTTGGTCGCTTCAAGCACTATTGCCACATGAACCCACTTGCCACAACGCACAGGTTC
TTTCGAAGTCACCCGCTCAAGTAAAATATGCTTTGACGACATGCTTGTTCCGATTGTAAAAGCGCGCTCTGACTCGGGCTTCAAGCTGACGACAAGACCG
ACCTCAAAGTGCCATGTGGAATCGCTCTCTGGAACAAGAATCAAGTACGGAGCGATCTCTTTGCTGTTTCCGCGAAGAAAAATCAGCCTCGAATCCGCGA
GTCGAGGTGACAGCAGAGATGCTGATGCGGGTAGCTTGGTACCGGATGACTGCGGGTGGTTGATGTATACCCACGTTGTGATGCTGAATACGTTTGGCTT
GGTCAGAGGGGACATGGCCGGCCTTGCTCCAGCTGAAAGAACCGACAGCGACGGACTGATCATCTCTTCGTACGGAAAGGAGAGGCCCTTGGACATGGAC
GAGAATCGCCTTGGGGCTAGAATGATCTCAAAGCTTCTCCTCATCGTAGGTACTGCTGGCATACC