Description :
From Genome Similarity Track
Location :
Scaffold_440:6653- 12268
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_440-fgenesh-gene-0.5Endo-1,3(4)-beta-glucanase
Pytve_DAOMBR484maker-pve_contig_440-snap-gene-0.19Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_440-snap-gene-0.12Proline synthetase co-transcribed bacterial protein
Pytve_DAOMBR484maker-pve_contig_440-snap-gene-0.13Proline synthetase co-transcribed bacterial protein
Pytve_DAOMBR484maker-pve_contig_440-snap-gene-0.21PIH1 domain-containing protein 1

Sequence
5615 bases(100 bases per row)
GGTGCACGTGCCGCTCGTCTCCCAGTTGTACGCGTACGTGTTCTCGTCCTTGGCCTCCACACTGCCGCCGTCGAGGATGCACGTGGCTGACGCATCGAAC
ACAGACTGCTGGGCCGTGTTGGGGATGTAAGCCAAACGCATGGTTCCCGTGAGCTTGCTCGACCCAATCAGCGTCGACGTGCCGCTGAGCGTCAGCGTCA
CCGACGTGGAAAAGTAGAGCGTCCAGGTCTGGCCGTTGTTGAGCGTGAGCACGAAGCGCGTGCCGGTCGTGGCGAGTCCAGAGGACGCTGTGTTGCCGTT
GATGGTCAGCACGGCGTAGACCGTCTGGATGTTGGGCGTGAGCGTCGTGAACTTGGCGGTCGCGTACGCCATCCCGCTCACGAGTGTCGACTCGTACTTG
CCGATCGAGTTGGTGTAGCGCACGCTGACACTCAGATCGTCCCAGTCGAAGATCTCGAACGTCGGGATGGTCGTGAACTCGGAGGCCGAGATGATGAAGT
CGTTCACCGACCCGTGCAGGTAGTACTGGTACGCACCGCTGTTGCCCGTGCTGCCACCAAACGCCCGCGAAGGGTACGCGTAGCTGAAGGCGAGACCGAA
CGGCGACGACACTTGCGGACGGACAGTGTACGGATTGGCCCACGCAGGCTGCACCGCCGAGTCGGTCGTGTAGGCGATCATATTGCCCCACCAGTTGTTG
GTCGGGATGGCGCGGCTGCCGACGATGCCTGAAGCCAGGAACTTGGGCGGCAGGAACGACGAGTGTGCGCTGGTCGATGGCACCAACGTCGAGGGCGGCG
CACCAGTCGAGAGCGCTTCAAACAGCTCGAACTCGGAGATATCAGCCACGGTGGAGTTGTCAGCAGCGCTGGAGACGCCCACGGCCAGCGACAGCGTCGC
TGCCGACAGCAGAGCGCGGCCGAGAGCGGACAGCTTCATGAGGAGCAGTTGCAGTCACCAGTGAGTGCCGACTTGGATGCTTGAAGACGCTTGGGGTGCC
GAGCAAGTTCGGAAATGGCAGTTCCAGATCCGGGCGAATTCGACGGCCGAGAGCTTCACCATCGCGGGAACTCCACCGCCACCCCTTGGCCAGGTTGCCC
TGCTTGAACTAGCGCCGCGACGGCGGCTGAGGGCGTCGCCTCGCCCGGTGCTCGGCCCCACTTCCATGGCGCTCGCCGCTCAGCTCATCTGCCGTTGCGG
GCAGATCTGCGCTTCCTTGAAGAACCGCCTTGAAGTGCGGGCAACTTCCCCATCGGACGCTTTATGAACGCGTGGTGCTACGCCGTCCAAGGCAATCACC
AAAATGACTCGGTCGCCTGTCCGATCGTGCAGGCAGCGCATTTTTGTGTCGGCAACGCTTCGTTCCCATAAAGCAGACGGCGGCGCTCCGTCTCCGCCAG
TCACACGACGACTGGCTGTCCGAGCAGTGTCCGGATCGCCTCGGCTCCGTGTCCGTGTCAGGGTCAGTGCCACTCGCCTGGCGCGGTGGTGTGGCTTCAA
TCTGATTCGCGCGCGCTGCTCCTCCTCTCGCCACTTGATTTCTCCGCCTTGAGCAACACTGTCAGGGGCTTGCGCGACCGGCTTGCTGAGCTGGCTATGT
CCCGCCGGAGCACTGCGACTCGAACGCGAACACCGCAGCCACGCCCTGCGCGACTGGCGCTTGCTCCGGCGTTGGGTTTACAGCGAGATGGGGTCTCCTC
GCTCGCAACTTCAACTTTGAGGGCCATTCGAGCGACATACCTATCGTGAAGCATATTGCTGATCACAATATGCGGTAGAGGAGTATGTGAGCGATCGGTG
ACGGTAGCTGTATCGAACGGTGACACTACCCGAATGACCATGGCGACGAGCACGGTGGCGGCGAACCTGAGCGCTGTGCGCGCGAAGATCGCGGACGCGG
TGGCTAAAAGCGCCTGGAAGCAGCAGGTAGACGCTCTCCCGCGTTCGCTGGCAGTGTCTGCCGCTTGATGCTCTCACTGACGCGCTGTGGACGTCGCTAT
TCACCCAGTGCACGCTCGTGACAGTGAGCAAGACCAAGCCGGTGGAGGATCTCCAGGCAGCGTACGAGCTGGAGCAGCGCCACTTTGGGGAGAACTACGT
GAGCGAATGCGTGGCGCTGTGCCTTTAATGTTGTGTAGAGGGGAGTTGATGCAGACATTTGACCCATGCAGATCCAAGAGATCGTCACCAAGGCGCCGGT
GCTTCCGGCCGACGTCAAGTGGCACTTCATCGGACATGTGCAGTCCAACAAGGCCAAGACGCTCGTGCGCGACGTACCCAACCTGTTTGTGGTCGAGACG
GTCGACTCGGTCAAGATCGCCAACGCGCTCAACAAGGCGTCGGGTGAGTTCCGCGCCTCCAAGCTCAACGTCATGGTGCAGGTGAACACGAGCGAGGAGG
AGCAAAAGTCGGGCTCCTCGTTCGAGGGCTCGCTCGAACTGGCGCAGCACATCGTGTCGTCCTGCGAGCACCTCCAGCTCACGGGACTCATGACCATCGG
ACGCTACGGCGACACGACCTCCGAGTGCTTCGACCGACTCGTGGCTTGCCGCGCGCGCGTCGCTGAGGCTCTCGGCGTCCCCGAGGGCGAGCTCGGACTG
AGCATGGGAATGTCAGGCGACTTCGAACTGGCCGTACGTGTTGTGGTTGAGTGGTTGCTGATGATATTGGAGGCTGACCGACAAGACTGTTTGCTCGGCA
TAGATTGCGTGCGGCAGCACCTTTGTGCGAATCGGCTCGACCATCTTTGGCGAGCGCAACTACGTCAACAGGGGTTAGATGCAAAGACGGCGGCATCGAC
CGAGACATCGGGGGACATGGTAGAATACATTGGCGCCGGATTGTCGCGGAGCTATCCTTACAGCAGCTCGAACGCCATGGCAGACTTCAGGTCAAACTCG
TCCAGTTTCCGGCTCTCGGCCCACGTTGCTGCGGCACGCTTGGCCTCGTCGGTCGGAATGTAGTCGAACTTCTCTTCAGACGCGTGGGCCTTGTCTTGAC
TCTTGCGCTGCTGCGCCAGTCTTGCTTGTTCGTCGCGAACGATGTTCTCGATATCGACGTACGTCGTCTCGGGCTCGTTCGGGTACATTTCGCGCCACGT
CTTGCCGGCCTCGCGCGCCTTCTGCTGCTTTTCTTCCACCTCGGCGCGCTTCGCCTTGCGCGTCTCGTCCGCCTCCTTCGCCTTCTGGACGCGCTCGAGC
CGGCGCTGCTCGAGAATGTGCATCGACATCATGTCTTTGCGGTGGAAGCGATCCTCTGGCAGCTCCTCGTCTTCATCCACAGGGTCCCATCGCGTTGCTT
GCTGCGCCATCGACTCCCGAATCTGCCCAGCAACCTCGGACTGCTGCACAGGCATTGCCAGGTGGAACATCTCGGCCAGTGACTGTGGTTGCTGCGGCGA
CACTGTCGCATTTTGCTGACCGCTTGCTGTCCCTGAATTCAGATCCTGTTCGTCGTCTAGCGCATGTGCAAGCAACCACGGCGCCGAGCCAACATCGGAA
CTCTGCTCGTCCCAGCGCTTGTCAATCGGTGCGGCGATTGCCAAGCTGTTGGTCTGTTGGTTAAGCGTGACGCTCGCCGGTTCTGTCTTGATCGGGTACG
GGAGAAAGATGTCTAACACACATAAAAGCATGACCGAAAACACAACCAATGAGTGCTGCCTCTCAGTGAGCAGTGGCAAGGACTATACGCACTGAGATCG
CGGTGACCGGTAGCCTTGACGCTCAGGTATTCAGGTTGCAGGTCAATTTCGATGCCACTGCTGTCGACTTCACTCTCAAAGAGCACGTTGATCACCAGTC
GATCGCCGGCTCGCTGTAGAATCTGAGGGGATAAAGCGGCACCGCCCTTGTCGACCGCTGGAGTTCGAATGCAGAGCCTCCGCTTCGTCCCCGTGCCATC
TTCAGCTAGCTGTTCCTCAAATACCTCACATCTGGCAGTCGCAGTCTTCTCTCGCTTCGCTACCTGTTGGCGAGCTGTAGCTGCCGATGTCTTCGACACC
GACTGACTCACTTCTTGAATAATTGGCGCTTGAACCTTGCGGATGTAGTGTCGAGGCGGGGGCAATTCACCTGCGTATGTCAGTCGAGGGAGTTTGTAGC
GAGCATCCAGTTTGATTTGGTACTGCGCACACCATAAACACGAAAGCCTCCGTCAGCGAGCCGTTTTAGTTGCCAACCTAAAGCCTCCCCTTGATTCGAT
CGACTCGTACGGCACCTTCTGGTCAATGTACTCGAGCGCTAGCTCACACACGAAGTTGCGGAACGTCCCAGTTTTGTCCTGCTTGCAGTCGTCAACCACC
TTGGTGTTCACTGCGACGTCGAAAGCCAGCGACTGCTGTCCCTTCTTGTCGGTCACTTGATGCGGAGCTCCCAAGCTCAGAGGGATATGGATTCCCTTCG
CGCATCCATTAGCAATCGACCACTAATGAAGACACACACCAGTGCTCAACCTACCTCTTGTTCGTTCCCGTGTTCATCGAGCTGTTTCTTCTCGGAGAAC
GTCTGGATGGCCTCCGCAAAGCAAACGTTCACGAATACCTAAGAGAGTCGTTGAGTATGTGAGCAGGTCTGGTAAGGCGGCAATACATTCGCAAAGACGT
GGATAACATAGCCCACCTTCTTGTTGGCTTTGACGTCTTGAGTCTTGATGACGAAGCCAGGCTGCACGTCAATGTACAACTGCGCGTACAGCACATTCAG
CCGTGGTGAGTGATGTGAATAGCAGACAGCTAGCAGGTGAACGTACGCCTTCCGTCTTGGCCTTAATTCCATCCGCTTCCATAACTTTGTCGCCGGGAAA
CTTGGGCAGGAAGGCTGGTCATGCACGCACAATACAACCTAAGCCAGCAGCAATAGTACCGCTCGCGTTAGTCGCTCCAGTACCTCCTGTGTCTGGGCCG
AGCACGCCGCCGTTTGCGCTCCGCTTGAGCCTATCGAACAGCGCCGCGTCCGAGTCTGTCGGACCGGCAGCACCACCCCCGAAACTCCCATCCCCCATGC
CAGCGGCCTGGATCTGCTGCTGCATCGTGGCCATGACCTGCTTGTAGCTCTCGGGGTCGCTCTTCTCGAGCTCATCGAGCCACTGCCGCAACGCAGTGCT
GCATCAGTTGTGTCACGGCAGTTAGGGAACCAAGGACAAGCCGCGTACATCAGCGTAGCGCTCGAGCGCCGCCTCGTCCATGGGTGGGAACCCGCCGCCT
TCCACGGAACGCGTCGCCATTGCTCTCGAGTCGGAATGGAGCAAGCGTCGCGACTGCCGACGCTTTGATGAGCATGGACCAAATTACCGTCAGCGGTCGG
ATAAATGCGAATATGGAATCGGCGGCCCTTCGATGGCTAGTGTTCAACATGGTGCAGCAAGCGCTCGCTCGCAATGGATCGCTGCATGTGGCCTACGGTA
TCCGCAACGGACTTTGCTATCTACCTGTGAGGCCCATGGCCACTACGAGCTCAGATGCATGCTCTGGCAGTGTATGGCAACGTTCACGCTGCTCTAGCGT
CTATAAACCATTCCCCAACACCGTGGTGGCTACTTCGAGCAAACAGCTCGCCAGTGGATTGTCTCGGCGCATGAGAGCTCATCGAGCGACACGAATACAG
AATATACGAGAGGAA