Description :
From Genome Similarity Track
Location :
Scaffold_950:6651- 8135
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_950-abinit-gene-0.21Methyltransferase 11 domain containing 1

Sequence
1484 bases(100 bases per row)
AGTCGACCTCTCGAAGCGCTTTACTCCTTCTTGTCCGTGTAAATGGAAGCGTCGGCGGGCCAGAGCGCGCCCCAGTGAGCCTTGCGCGACGCACGATACA
CTTCGCGGATATGCTTGCCCTTGGTCACACTGCGGCGCTCGAGTGTGCCCTCGGGGGTGCACACGTCCAGGTGGACGTGGCGAGTCGCCAGCAGTGGACT
CCTACAAAGTAAACATATCAATCTCAGCAACCCTGCTCAAAAGATGTACGATCACTAACTAGATCAACAGCGTACCGAATCATGCGCGCATAGCGCTGCT
TGGCATTCGGGTCTTTAGCCCCGTTCTTCTCCATGATCACGTACGAGAATTTGGATCCTTTCTGTCCGTGCCATCGCTTCGGAGTCATCTCACGCGGACG
GTGCACCTGCGGCGAGCGCTGCACAAAGTGACACCATGTTCCGCCAGCAGCTGGGCACTATAGATAGAAGCAACGGCAATTTTAGCATAGCGATAGTAGT
GTACACAAACCTCAAGTCAACATACCTCAAAGTGGTGCGGACACGGTGCCAGGATCTTGACGGTCTCGTCCTCCTCTTCGTCGACCGAGTCGAGAATGAA
CTGGCGCGCCGAGCGCACGTGGTGGGATCCCCACGGACTTCCTCGGTCCACGAGCACCATGCAGCCCTTGTCGCTCAAGAGCTCCCACATCGCCGAGGTG
ACGGCCACGCGTTCGTAGTCGTTCGTGATCTCCGACAGCACGTAGTTGAGCACGATGAGGTCGTACTTGATGCCGCCTTCGAGTTCACGCTTCATCTCGG
CGATGCTGCGGCGAACGCTCAAACCCGGGAAGCCCTCGAGCACGACCTCGGCAGCGTCCATCATCGACTGACTCGGCTCCACGACTCGGTAGCGGGTCAG
CGACTCTTCGTAGAATTCCTTGGCGACCCACGAAGCTGTGCCTGGGCCCGCGCCAAAGTCCAGCACGGACTCGGGCTTAAAGTCGGGTCGCTGCTGCTGC
AATTGGCGGAACACGTGGTGCGCGCAGGCGTACGTGCCCTCCACTTCGTACGACATGTACGCCATGGTCTCGGTCGGGCCGTAGAGGTACGCTGGGATTT
GGGTTTCCTTGTCGAGCGTCCAGCCGATCGGTTTCTTGTGCATATCGAGCGGGATCTGGCGCGTGTTCTTCTCGTCGTGGACGTACTTCTCGCGCAGCTT
TTCCAGCTGCGAGTGCGTGCGGCACTTGACGACCGTCGTGAGGCGGCGCAAGAGCTCCTCGGGCATCTCGACGCGCTGCTGGATGCCGTTGCGCGTCGTC
TCGTCGATACTGGAGACTATCTTCATAGCCTCGCGCACTTCGCTCAGGATGCCGCCCTTGCTGCCATCGCTGGCCTTTGCGTGGCGCAGGCGGCGGGAGC
GCCGGCTGGCGCCACTGCTGCTCGCTGGCGCCGTAGCGAACGCGCTCGTCTGGATCGCATACGCAGCATTGACTGTACGCAGTG