Description :
From Genome Similarity Track
Location :
Scaffold_245:6650- 10956
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_245-fgenesh-gene-0.0HECT ubiquitin ligase
Pytap_DAOMBR444maker-pag1_scaffold_245-snap-gene-0.20Voltage-gated Ion Channel (VIC) Superfamily

Sequence
4306 bases(100 bases per row)
CAGTCTCGCGAGGTGCTGGGGgACgACCATTTGGCTCATTTCCTCGCCGCGGGAAGACTCTTGGGTCGGTCGCTCTTGGAGGGTAATGTCACTGGCTTCC
ACTTGGCTTTGCCGCTACTGAAGATCATTTTGGGTCTACCTGTGGGCTTCACCGACTTGGAATACTTTGACCCCGAAGCGTACAAGAACCTGCAGTGGCT
TTTGGACAACGACGATGTCGATATGCTCGGTCTCGACTTTACAGTTGTGGAAAAGCTTGAAGATGGCACCACTCGGGTGGTTGAGCTTATACCAGATGGA
GGCTCTATTGACGTGACTGACGAAAaCAAGGTCGAGTTTATTGACCgAAAAGtCCGTTACCTTTTGTtCGAAAGCGTCTCGGAgCAGCTCTTTGCATTCT
TGAAGGGCCTCTACGAAGTCGTTCCAGTAGAGCTCCTTATGTTATTCGACGCTGAAGAGCTCGACTACGTGCTGTCAGGCTCCGATGAAATTGATGTGGA
CGACTGGGAGCGCAACACCATCACGTCGAAGAACCTAGTTGACCATGTAGCCCTCGCCAACTTctGGACGTCTGTTCGGTCGCTATCAACTGAAGACCGT
CGACGCCTTCTGCAGTTCGCCACAGGTGCTACACGTGTGCCTCCAGGTGGCTTCAGTGCCCTCACCAGCTATGATGGGCGTCTTTGTCGTTTCACTCTCA
AGGGGGTCTTGCCCGACCGCACGCGTGGCTACATCCGCAGCCACGCGTGTTTCAACCGCCTCGATCTACCCCTGCACATGGACGCACGGGAGATGCGCTT
TGCCCTCTCAGCCGCTCTCTCGAACCGCAGCTTCGGCTTCACCACTGCTTGAACTTGCGTCGTCTTGTCTCCATGTTTAGTCGCGTGCGTGTCGTGCACT
TCAACATGTTACCGTATACGGTAAAACAAACTACAATTTTATAGACATATCCGTAAGTTTGCAAAATGCGTGTTGTTTTTCTCTACAACTCTCCAAAATG
GACAATAATAAGGCGCTGCTGTTGTGATGGACTCGTCGACATGACTAGCGTCTACCCCGATCATAGGTCGACTTGATCCTTTCCTGGCTTAATCAGATGG
TGGAAGCATCTTGGCTGCAAGTGACGTGCTGTTCATGCGACTGCGGGAGTGTGCCCTCCGAGAAGTGGACATATCGCGGCTGCCGCTGCTAGAGACGGTT
GACATCATGCTATAGCCGAAACCTTCATGCATACTAGCAGCGCTCATCATCACGGGGAgATTCACGTGGAAATCGTTCGGCGTGATAATCGCTCCACCTA
TGGATtCGGTTGATACATCTGGCGACGGCGTCGGATTGTTCCGCACCGAGGCAACTCGAGCGTATAACGAACCGTGCGGAAGTACCAGTCGAAGGAACTT
GTCAAACATGCGTTGGCACGGCTCTGGGTATTTGAGCGCACGCATGGGAGCCATTTGATTATACTGAGCAGCGGTGATGCGACCAACTTGCCACGACTCT
TGCCACTGTCGTTGATGCTTTACTATGACTCTCAGAAGCACATCGCCCCAGGGCTCATCCGGTGTACTGATCCCAAGCAGCGCGGCTGCATCAAGTGCCT
CGGGGTCAAGTTGGCCAGACTTCAGCTTTAGCAACTTGGCCATTTCGCGGTAACTTTCTACAATTATGCTGACGGCTATCTGGAAGAGCGGTCTACTTAG
CAAAACTTCAAGTAGAGCCTCCGAAGTTAGAGACAGCAAGTCGCAGGCTCGCACGCTCCGCACAGTGTTGCGACTCACAGCGTACCCTAAGAGACCTCGT
TCACCAAAACAGTCTCCACGTCTCAGGTAAGCTTCTCTTGGAAGGgTTGgAGGGgCTGCATGCGCTGTTGACTCGGCAAGAGGACCAGCAAAATTCAACG
ACGCTGCTAACGCTGCTGTGACAGCTGCTTCTGTGGATGATCGAGACACTAGTACTCCcTtcACGACGAAGTACATCTCTTtCGTGATACTCCcTtCAGC
GAGAaTGCACTCGTCACGaGGAAAGCTCTCGtATTTCAGTTGCTGAGCAATCGCTTCGACAATCGCGTCAAGTTCGTtCTTGGCAGCTGGTCCATCAGGT
AAGAGAGGACCTAAGTAACTCGAAACGAAACTCATCAACGGCTTCTGCGCGACGTGCAGAACTACATTATTACGTATCTCGAgTGGGAGATCATCGAGGA
TTGCCTGGTAATTGACTCCTCGATGGGAGCTCCAGAGACTCGCAAGAAACGCGTTTGCACGATCCTGTAACTTGGGACTAATACGCCACCGCTCCAAGTA
TTTCTTCACGGCAATGTGGTGATGACGAAACTCCACTTCATTGCTGATGTAGCTGGAGTAAAGGTTGGCAACCTCACCGATCATGATTGCCATTGTGAGA
AGCCCAATGAATGACACAGCCAAAGTAAAGAACAGCTGTGACTCGGTCTCAGGAACGAACGTTTTTCCTTtCTTGATCACAGCAGTGACTGCGAAAAAGA
AACTTCGAAGTAGTCGCATGGCTAACTGTCGCGAAGGTGATTGTGCATGTTGCACATCTTCCGACAGCAGTGACGTGGGTGGTGCCCACTGATACCATGA
CTCCGAGAGGGACGCAGTTGTTGCTTTTGCAACGACAACGTACGCACTCGCGCACCAGAACATAGCAATGAGAAaCAAAAGCCAGCGCGACACGAAGCGT
GTTTGCTCGTATCGGACACTACGTCGATAAATCTCGTCAACATAGTGCTGAAAATTGATCACCTTGATGCAACGGTTAACTCGTAGCCACGGGGAGTCAT
AGAAGTCCGACAAAAAGTGGTCAATGGGGAATGCAGCGAGTGCATCCCATAGCAAGCGGTGCTCCTTCTGGTATGCAGTCCGATGTGGTGTCTCGTAGAG
CTCCATTGAAAAAAaCGaTTCTTTCAAGTTCCAGTTCATCCAAATATCCCACGCGAACAACAACTCACACACGTGCTCCAGTGCACGGGTGATGCGTGGA
AAGAGCATTATGACTTGAAGACCATTTTCATCAATATAGAAGGGCCAATCAAACGCAATGCGATATGGAACCGCAAGTGCCATGAATAGTGTCGCAACCA
CGGTAACGCGAAGCCAGAATACATGCGTCAAGCTTTGTACTTCGGTGCATTCCAAGAGCTTGTCGATCCAAAGATCGTTAACCGGCGTTTTTTGGGGCCC
CTTGGAAACAGATGCAGTGGAAACTGAAGAGGCAGCAGCTGGGCGTGGAGACGGTGGTTGAGGCTTTGATTCAGAATTTTCGGGTGCCGTGTCTTGGGTC
GATGTCGAAGGAACTGTGGCAGTAGTCTGTAACGGTGCAGAAGCTGGAGCTACTTGGGCAGGACGAGGCAATTGAGTTGTCTGCTTAGGTGGTGGAGTTG
GAGGAGTGATCGATGGCTCTGGTAGCTTTCCTGAAACTCTACGGACGAGTCTTTTGGAGCCTTCCATAAACTTATCTGACATTCGCCTCGACATAGGGAT
GGCAGTCTTGTCGCTTAATTTGTCCTCTTGGTTGTGATCTTTTTtGGCTGCGTCGTGCTGTTGCTCTGCCATGTACAGGTTTCGAAGATGCTGCTGCTCT
TGCTGGATGCTAACAATCTTCAGGACACGTTTTTtCCACTCCGGGTATCTCTCGAAGACGAGTTCAAGCGATCTCCGGGAAAGCTTATACAAAACTGACG
ATGTTCGAGCACGCGCGTCGGCACTTCGTGGCTTGCTCGTGAAAAGAGCAATTTCACCGAAGTAACTGCCTGATGTCAATTCATTCACTTTTTtCATGAC
GACTGGATGCAAAAGGGATGAAGAAGAGGGCGGCGGCGTCGCCGAACCAAGCATCGATGGTTTTTtGGTATCGGATTTGTTCTCCTTGGCAGCTGCTGCG
ATTACACCACCGTTTGTCGCGGAATCACTGTTCAGTCGGTGAAGACTAGCGGCAGGCACTAAGACGTCGATGACGCCGGTGAATACAAAGAATAAATCAT
TTCCCATTTCTCCGTGGCGACAAACATACTGATCCTTCACAATGAGTACCTGTGAGAACTGCGACACAAGCATCCGCATCACTGACCCTTCCATTCCAGC
TAAGATTGCAACCTTGACGATCATAGGCTGCAGGTGAACTAGTCGAATGTCCGTGAGTAGAGATGGTGGAAGACAGCCTTCGAGAATGTGCTCCTGAGTA
ATAGAATGAAATCGCTGAAAGAAGACGTACGTTTTGAGCTTATCTTGGAGAGAAGTCGGTAGCGCGAAATGTTTCAGCAAGTGTCGTAAAGAGGCTAGCT
GAGCAT