Description :
From Genome Similarity Track
Location :
Scaffold_4289:665- 1837
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_4289-fgenesh-gene-0.0Transposase

Sequence
1172 bases(100 bases per row)
TACACCATTTCCCAGTCAAAATGCAAAACGTCCCATCTGTCATACAAATTGAGGTTTTATCATATTAAACCTCAACGAAGCAAAATTCAAGGTTTTAGCA
CTTTGTTCCAAAACCGCAACTCATGGTACTTTATCGTCTCAAGCAAAACGCAAAATGAATCAACTTAAATTAGGTGCCAAGCTGCATGTCCTCGCCGCGT
TCAGCCGCGAAACGCGCGCGCATGCAATGGCGCTCCTCGCGCCGCACCAATTGCGTCGTGATGACATGTTTGCTCGTCTCCACTGCTTCCTTCATCAAAT
CAAGGCAGTGGGCAGTGTAGGTATTAAACTCACCGCGCACCAAAAACTCATTCTTCTCCACGACCATGAACTCCCTCATGCGGGCCTTGAGGACGCTCCA
GCAGTCCTCAATGGGGTTCAGCATCGGGCTGTAAGGGCCGAGGCGGAGGCGGAGGATCACGAGCCTGTTCCCGTTCATGACGCCGTCGGCGGCCAATTGC
TCTCTCGCCAAGTCCTCTACGCCGCTGTGCGCCGGCGCATTGTCGGTCATGATCACGACCTTGTTCTCTTGCGCGAGGGCGCGATATTCCGAGGTGTGTA
TCGCGGCGGTAAACATGTCGGCGATAAATCGAGCCGTCGTGCGTCTTCAGCAGGAGGAGGCCCGACCCAGACGCGACGCCGCCGATCACGTGAAGATTGT
TCCCTTGCGATGGCGGTAGCTGCTTGGCGCGCTCGCCGACACGCGATCAGCCTTCTTTGCGGGACAGGTACAGGTTGAAATTGGTCTCGTCATGATAGAC
GATCATGTCTCCCTTTCCGACGTGGGCGTTGAGCTTCTCGACGAACACCTTCCGCTTCTCTTTGCTCTTGCTGTTGTTCATGGTCACTTTTTCGATGCGC
AATTGCTTGGTACTGTAGAGCATGCCCTTTAGAGCGCGATGGACAAAGGACATGCTCACGTCCACACCCAAGTCGCTCTGCAGGTGGTCGCGCATGTTAT
TGAGGGTAAAGCGGCAGTCCTCGTCCAAGTACTCCTCGAGTTTCGACATGACCTTGACGGTCATCTTCACGGTCGAGGGCTTCACGCCGCCGCGCGGCTT
GGGCGAAGCTGCGGCGCTCAAGATCGCTCGCCGCGCAGTGTGGTAGGAGACATCGTTGGCGTCTGCGACCTC