Description :
From Genome Similarity Track
Location :
Scaffold_8:66496- 69207
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_8-snap-gene-0.39Peptidyl-tRNA hydrolase
Pytul_var.sporangiiferumfgenesh_masked-pug3_contig_8-abinit-gene-0.88Calcineurin-like phosphoesterase

Sequence
2711 bases(100 bases per row)
AATGGAAGAGATCGCGTGGAAGTGCTCGGCGGCGTTCCTGCTCGGCGCCGCGACGCACTATGTGATCTCGCGCNNNNNNNNNNNNNNNNNNNNTGAGCGA
CGAAAGCAGCAATGTGCGCGCTCCCACCTCCGTGAGAGCGGAGCCCGCGAAACCAGCAGCAGCAGCAGTTGACGCGAAGGGCGCGCAGCCCGAGGAAGAC
GGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGACGAGTCACAGAGCTGGCAGCCGCACAAGATGGTGCTTTGCGTGCGCACGGAC
CTCAAGATGGGCAAAGGTATGCGCGCTGCGTTGTGGGGGTTGCATGAGACGCGATGCGCATGGGGCTAACATACATGCAATACGTGACTGATTCCTGCAG
GCAAGATCGCTGCGCAATGCTGCCATGCGACTCTGGGCGCGTACAAGCGCGCCGTGAAGCGAGCTCCGAAAGCCGTGCGCGCGTGGGAGATGCTGGGCCA
GGCCAAGGTCTGCCTGAAGGTCGACTCGGAAGAAGAGCTCTTGAGTCTCGCTGCCAAGGCGTCCGAGCACGGACTGATCAACTACGTCGTGGTGCGTACT
AATGTGTGATGCTGCATCAATGTGGAAGCCGAAACGCAGTGTTCATTGCGATCATATGTGCTTTTGTCGTTTTTTCTTAATGTGTGTGCGCGCGTAGGTT
GACGCCGGACGAACGCAAATCGCGCCAGATTCCAAGACCGTGCTCGGCATTGGTCCCGCGCCAATTGACGCCATTAACGAAGTCACTGGTCACCTCAAGC
TCATGTAAGCTCGCTTTGCATGGTTTAACTAACTAACAGGAAAAGCGCTTGATCCAACGACAGCGGCGGCATAGTTTTCTCTCTGTCGTACAGATGCGAT
TTCTGCATCACTGTTGTGTGTTGTATGCAACGCAGTATGAACAACAATGCGATGGTGCTCGTCTCTTTATACCTGAAAGCAACTCTTTCCTGAAGACGCT
GTCTAGACAGTTTTACCATTGCTGTTCTCTTACAGCATCGGGAACAATCCCTCCCGCTCACGGTCGCGCTCCTCTGGACTCTTCACGACGCCACTTCTNN
NNNNNNNNNNNNNNNNNNGCAACCCACGCAGCACCGCGAGCACCAGCGCGATCGCCACCACAGTTGCGAGGACAGTCATGAGGATCGCAACATACACGTC
GGACGGTGCCAGGTTGTACGACGAAGTATTGACTTTGTTGCTCGCCTGGACAATCTTAGAGACTGACTTTGCGCCGTCCACGCACGCGAGGTACTCGCCC
TTCGTGCTCCACCATTTCATCGAACACAACGTGTTGGCGTGGCAAACGTCCGTGGCGCAAGGTGGCGCACGATGCGACTGCGCCTTCATGTTCCAGTAGT
ACGCTTCGAGAAGAGACGAGTCTGCTTCAACGCGCTGGTAGAAATCCGTCAGGTCGGTTCTCGAGAGTGACTTCAAGCCGTAACTTCTGCGCATTTCATA
CACACACACAAGATGGAAGTCAGTATCATTCATCAACGTAAAAATACCGCCGTATATGCGTGAACGTACTCGCTGGCTTTGAAAAGGGGCTTCCAGTCGA
GCGTCTGGTCGACTTCCGAGATGTTGGTGCCGTAGACCGTGAAGTCCAGCACTTCGTACGTGCTCGCGTTGTAATCCCAGACCATGAACGACGGGTTGTT
CCCGAACAACGGCGAGATCGAGCCCGAAACAAACAGCGGCACGAGCTCGAATCCCGTCGCGTCTGACGAGGTTGAAGGAACGCGAAATTCGACACTGTGC
ACATGGCCAAAGAACTGCGCCTTGATCACGTCCGGAAACTTGCCCACGATGCTTTTGTATCGGTTGATGTAGGGCACGTGCCATTGCGGGTTCCCACCGT
ACGAGTCGACAATTGGTGCGATGTGCCCCGTGATGTACGCAAACTTGCCTTGTTGTTGTAGGTTCGTGAGCGTCGCGTTCAGCCACGCAAACTGGTCAAA
CGGGTCTTCAACCCCCGACGTGTCTGGTAAATGACTTGGCTACGAAACGCAAAGACAAGAGAAACACAACTGTGAGAAGCATGAAGAGCGGACAGCTCTT
GTGGAGCCTATTGTAACGTACCGAATATGGAACAGTGTTGAGCGTGAGCACGAGCAGCTTTTCGTCGAGTTCGTACGTCAAGTAGCCCCTGCGGTTGAAC
GCCTCAAAATCCGACTGCGAGAGCGATTCACTCCAGGTCTTGGAAACCTTTTGAATGGATGGGTTCGCGTTCTTCTGGGGATTCGTCACCTCCATGTAAT
AGTCCGGGTCTAGATAATATTTTTGTACCAGAAGGACAAAAGGAAACGTGAGTCCTCGACGATCCAACCACAGATAGATGATACACTCGCCCAATCAAGA
TACAAGAGTCTCCGTGATAGGCTTCATATAATGCAGTCCAACGTACTTCCATCGGCATTCCCGATAATCGCCGTCGTCTCGAGCATCTCGCTTCCATGCG
NNNNNNNNNNNNNNNNNNNGCGCATAGAACTTCTCGATCGTCTTCACATTCGTCTCGAGCGCCTTGGCGATGTACTCGTCCGAGAACAGGCCGTGCGCGA
CGTGGTCGCCCGTGTACAGAAAGAAGTCCGGGTGTGGCAGAACTTGCTGCGCGTACGTGAGTGCGGACTCGAGCAAGCGCACGGGCGCGTCGCGGCCGTA
GTGGAAGCGGA