Description :
From Genome Similarity Track
Location :
Scaffold_112:66496- 68607
Transcript NameFunction/comments
Hyaar_Emoy2809883WW domain, G-patch, C2H2 zinc finger

Sequence
2111 bases(100 bases per row)
CCGGCACTTTTTTTGCTTTCTTACCAATAAATCGACTTCGCCATCGAGTAAGAAATCGCATGAGGCGACCCCGGGAAGAAGCAACACATGGATCTTTCTA
CACTCGTTCTCGCGAGATGCTATCTGTATATTATATTATACAGCCTCCCTTTCTTCGTCAAGTGACATCTATATCGCTGCTTCTTTTGATACAGAAATGT
GCATCATGTCCTTTATCGACTTCATCGCCACCTTCCCTGTCCTATTCGTCTTCTTCATTTTTTCCTATTTCCATTCCATCTTTTTTGTTCCAATGATACT
TTTATTCTTGTTCGTTGAATGTCATTGGAAGATGTGCGTTTTCGTCGTACTATTTTGAATATGTGTTAACCCTTAAGGGTGCAGTATTGTGGCCTATAGT
CCTTCTTGTAAATTTTTTTTTGTGAAAATAGGATACTATCACTAGACGTAAGACGCTTTCTTATCTATATACTTACAATTTTAGGCTAATAGTGTCCGCA
AGAGACTTCTGCAATGCCGCCGCTAGTAATCTCTCCATGGCATCGACCTCTCTAAGTCCAATGACAATTGGTGGGGCTGCTAGGCCACTGGACAATGCCA
TATTGTCTTATCAGTAATTCAGCTTGCGATGGTATACAAGAGAAAACGAGTTTTCTTTTCATTTAACATTAATCAATCTTAACCTTTTGCTGCAGGTGTT
TACTTAACGAAAAAAAAGGGAGTGAATCTTACCAGAAATGGAATGAATCTAACAATTCCCTATTCTAATTAACAGCTATTAGTGTTAATTAAATGTAACA
GGCTCACCCCGTTACAGTAGGACCGTAAACAAATTATAGATTGATGTCTGCTAATCGAGGTCCACAAGTCGTAAAACTAAACATGTTACACCGCTGGCAC
TTTGTCTAAGAAGCAATTGCGCAATTATAGTCTGCGTATAAAAAGCAGGATAGGAATGCAGCAATGTGATATTACTTACTGCGATGTGTATCTGCCGTAA
TCTATACTAACACCATTCTTTAGGGCGATATAATACGGATACATTTTGCACGAGTACAACACGTTCCCGAATTATAATCGCATATTTCATATATTAACCA
ATTATGAAAATTACTGAAGACATGTCTTCTGCTTCAAAGGCAGAGCACGCGCTGGACGCGTCCAATCGCGGCTACCGTTTGCTGCTCAAGATGGGATGGC
GCACAGGCTCTGGATTGGGCAAGCATGAGCAAGGTCGATCGCCGTATTTCACGCAGCAAGAATAAATGGATTCTGAAAATAATTAACTTTGCTGTTTTTA
TGTTCTGGTTTCGCAGGTATCGTCGAGCCCGTAAAGATGAAAGAAAATTTAGTGTGTCTCGGGCTTGGAAAAGCGGTGAGTCCATTGTTTAATTTGTACA
CATTTTTGATATTGTTGTTATTATCGATACTATAATTTATGTATTGTTCATTCATGTGTCCCCAGGAAGAGTACGACCATGTGACGCAGTTAGCAACAAG
CGAGCGTCGCAAACTGGAGTCCGAAGTGCTGGAAACGGCTGAACAAGTTGCTGTTCGCGAGTCGAAAAGTGCAAAAGATGAGCAAGTAAAGGCAGACGTT
AGGAATATGCAGGCAGCTTTCTACTGCTCAGACTGTCGAAAACAGTACAAGTCGGTGACGGAGATGGAAAACCATTTGAGTTCGTACGACCATCATCACA
CGAAGAGACTAAAGGAGTTGCAGCAGCACAAACGACGAGTGGGGTCTGAGGGAGAGCAAAATGCCAAGCACGAGAAGCAGCAAGTGAAGGAACGTTTGAT
GTTGCAGCGAAGAATAGCTGCGCAATCTCAGGCAGCGCGAGCTGACACGGAAAAGATTAAAGGACCAGCCGCTGATGTAAAATGCGACAGCGAGAAATCT
GCGACTACAACGACAGGCGATTTCGAATTCGGTGGAGGAATGAAAATAGGCATGAAGAAGAAGAAGGCGTTGGCTAAACGCAACGTCCCTTCGGCTTTTT
CGAATCCTTTTTCGCAATAAAACCATTTCATTGTACGATGTAAAAAGGGCTGGTCCGCTGTGTGTGAACGTTAGAAGCAGGTTCTGGTTTGTGATGCAAG
CGTAGCTTAGC