Description :
From Genome Similarity Track
Location :
Scaffold_83:66495- 67498
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_12110zinc finger nuclease ALPFOK

Sequence
1003 bases(100 bases per row)
TCGACGGTGGTTCGTTTGGTCCTCGTTCTTGGCCTCGGTGCTGACAACGATCAAGTAGAGGCATTTTATTATAGAGACATATATTTGGGGCAGCGACTTT
AGTACATCCCGCCATCGTCACACAGCAGTTCTTCCAAGCGCCATAGGTCACTCCACGGCTCATCCGGGCGGAACTGCGGCGCTTGAATCGGCTCGAGGTC
CACTGATTCGCGAGGCATCGCAATCTCTTGGGCAATACGGCATCGCTGTTTCTTCTCACTCGCAAGCGGCTCGTCGTCGTCGTGGAGGAGCTGGCTCAGA
TCCACCCACATACTCGATCGCGCATCGACTCCAGTGCTCGCATGCGCCTGCATGGTCATGTGCCGCGACAAGTTGCCCGACGTCGAGAACGACCCGCAAC
AGAGATGGCAGACGTACGGCTGCAGCCCAACGTGCGTCGAGAGGTGGCGCACGAGCTTCTCGCGCGAGCAAAACCGCTTGGCACACGTGCTCCAAGCGCA
GGCAAACGGCTTGTCGAGGCGGTGCGTGTGCGCATGCCGGACGAGGTTACCCGATGTGGTAAAGCTTTTCCCACAGTTGGCCTCGACACAGACAAAGGGC
CGCAGTCCCGTGTGGGTCTTTTGGTGCTCGTGCAAGGTGAACTTGCGCTTGAAGCGCTTGTCGCAGCCGTCAACGGGGCAGGCAAAGCGTCGGTCGGGCT
CCATGGCGTAGCAAAAGTGAAAATGAAAATGAAATTTGTGGCCTCGAATCACGCGTGCCTTGTTGACGGGCACCGAACAGGATGTGCGGTTGCTGCCCTT
GGTTGACGTGGTACTTGTTGGCCTTGGAGCCAGCATCCGGGAGGCCAATGCAAGATAAATTCGGGGTGCCGAGGGCGACGGGCAATGGGAAAAGATACCT
CAACGTTACGCGTCCTACTGTGTACTCCCAAAATGGGAATCTCGTGAGCCCGATTCATTGAGTTGCGACTGCGATCACTGGACGGTGGTGCGAAATGCTG
TCG