Description :
From Genome Similarity Track
Location :
Scaffold_140:6648- 8164
Transcript NameFunction/comments
Sapdi_VS20SDRG_16623hypothetical protein

Sequence
1516 bases(100 bases per row)
CTTTGGGTGGTGCTTTTCATATGCGTGGGCGGCCGGCACGCGAGAAGTGGTTTCGTTTCAAGGTGATGCGCGTCGCGTCACGGCCATCTCGGGGCCCTTG
AGCCCGCTCACGATTCAGCCCAACCCGGCGGAAATTCCGCAAAATTTCTCCTTTGTGCTCATGGCCTGCGTGCAGTACATAACGTGCGTCTTTGTCGTAC
TCGCAGCGGGGATTGCTGTGCTGACACTCCGCCGTCTCGAGCACTGCGAGGGCCGCCACCTCTTTCAGATGAACCGCATGATTGGCCTTGTCTGGATTGG
CTGGCCGTTCTTACTGCTCCGGAGCCTCACGGCCATGGTGCTACTGCACACGAGCTCGCTGACGCTAACGCAAGTCGGCGGCCTCGCGCGCTTTACGTCC
CCCGCGCTGCCGTGGTACAGCTTGGTGCTCGTGTCCGGCGAAGTCAACTGGCTCGTCTACGTGCTCAACGACCTTTTTAGCATCGCAACCACCGAACTCA
CGCACGCGTACGCCAACCACAGTGCCGTGCTGACGTGGATCCTCATGCTGCTCTGGATCTCGGTCGCGCCGTGCCAGCACGCAGCTACGCTGCAGCGAGC
TTGCACGTCCATCAATATGGACGACCGCCTCGAGTGCCACAGCGCAAGCATTCGCGTCGGTCAGTTTTCAAGGCTGCCCACGACGCTTGCGATCGCCCTT
GGGAGCCTGGTCGTCACGTATAGCGTCGCGCGGTGGCGCCACCGGACGCTGCGGCCGTCGCCCCCCTCGGCGTTTCTCTCGTCGCCGGCCAAGTATATGT
TTGTCGTGACCGACTGGTGCGTCGACGGCGTTCTGTATTTGGACGCCATGTCAGCGCTGCTCGCCGGTCTTCTTTCGTTCGAGATGATGGAGAATATTGT
CATATTGGATGTGAAGAAGTGGCGCCTCCTCGTGGTCGCGCGGCGACGGCTCGGGAAGGACGCGCCGCCCCACCTCCGGCACGCGATCCCGCTACTCGAG
TAGTCGTGCGCATTGTGTTGTATATTTCGTAGTATTAGTGTTTGTGCTATCTGTCGGCGGGGAATTCACTGCCCAGACCTGGCTACATGCAGGCGTAAAA
CGGTTTGACCCACTTCAACCTCAAGTAGCTGCTGGAAGGGCAAGGGTTTCTGTTCTGTCCCAACGTCCGCTCATCGAGCGATCGTCAAGCTCGACTGGAT
TCTCCTTGTCCAGGCCATTACGCCTTGCGACGTCTGCGGACAGAGTGAACCAGATCTGCAACTTGGACCAAGCAAAGATGTCAACTCCCCGAATGCCAAA
TGGGTGCGGGTAGATGTGAAAAGGGACGTTATTAACGTTATTAGCTATGAAATTATGGTACGTCGCGAGGCCGTTGCCATATCGACTCGTTGTTGCTCGG
CTCCAAAGGCGCAGCGCTCTGGTTGCTCCATCACCCGCTTGGCTCCTGGTGTCCAATTCAGATCGGGCAAGTGCAGTGGCGTCTTTCTAGCGTGTCGTCC
GCTTGTGGTATCCGGA