Description :
From Genome Similarity Track
Location :
Scaffold_126:66460- 68049
Transcript NameFunction/comments
Phyin_T30-4PITG_20230Amino Acid/Auxin Permease (AAAP) Family

Sequence
1589 bases(100 bases per row)
TAACTTTACCTTGTTCATTTCCAATTCCGCCGCCTCGGTCGCAGGTTTCTCTACTATACACCAATTCGACTTCAATCGTCGGATCAAAGCTTCATCATCA
TGGCGAAAGGGCCTTTCCTAACGGGTGAAGACTTGAAGTCGTGTTTCAACCTCTTCTGCTGTATCTACGGCATTGGAACGCTTGGTATGCCGGGTAACTT
TGCCCGCTCCGGACCCGTGATCGCCGTTATCGCCATGACTTTCATGGCGTTCGCCAACATCTACTCGTCTCTCTCCATGTCCAAGGTTATGCTGCTGGCC
CCGCGGTCGGTCAAGACGTTCGGTGACCTCGGCGAATGGGCCATGGGCACGACCGGCCGCTGGTTGTGCATTGTCTCTCAGATGGGCTCTTGCCTCTTGA
TCCCGTGCGTTTTCCTCGTTCTTGGGGGTCAGTTGCTGGACGGCCTCTTCACGGATGCTTTCAGCCAGACCACTTGGATCATCCTCATGGCTCTGACAGT
GCTGCCGGTCTGTCTCGTGCCAACCCTCAAGGAAGGTTCGGGCTCTGCTTTCGCTGGCTGCATGGGAACTATTATTGCCGACGTTATTGCAGTTGCACTC
GTCATGTACGGCATGCGTGGTCACCCCAGCGTTCCGTTCCCGGAGTTGAAGCTCTCCCAGGTAGTTGGCGTGTTCGGTAACCTCACGCTCGCGTACGGCG
CCGGTATCGTCATCCCCGACATCCAGCGTCAGCACAGCGACCCCACCCGCATGCCTCGCGTCGTGCTTGTCACTGTCGGCTTCGTCTCGGTTCTCTTCCT
CGTGCTCGCTAGTACATCGTACTCAGCTGTCGGTTGCCAGATCTCGGGTAACCTGCTTTTCACGATCTACCCGGACAGTGAGACGGGCATGACGTCGTTG
GGCTTCAAGCCGGACTGGGGCATGGTGGTGCTCGCCTACCTGTTCATGCAGCTTCATCTTACAATTGCTTTTGCCGTTATCCTGAACCCGGCCTTCTACA
TCTCTGAGCGCGTGTTCCTGGGCATGCACAAGAAGAAGACCGAGGACATTGAGAATGGCTTCGCTTTCGAAGAGGTCACTACCCCCGCTGAACTCGTTAC
GAAGACCTCGGAGGCCGGCAACTCGGGACGCCAGCTGGGCAACCGCCGCTCCAGGATGTCGTACGTGTCGGTCGCTGACTCGGAGCGTGTGCACAAGGAC
AACGAGGAGGAGGAGGCAGCGGAATACACCGGCGCGAACGTCATCAAGTACGTCATTCTGCGTATCATCATTGTCGTCATTCTGGTGGCAATGGCCATTG
CCTTTAAGGACCACTTCACCGAGTTCGCCGACTTCGTGGGCGCTTCATGCATCACCACGAACTGCATCCTGCTGCCGGTCCTTTTCTACCTTATCAAGTC
GTGGGAGCGCGTTGCTATTTACGAGAAGGTGGCGGCTATTATTGTTTTCGTGGTGTGTTTTGTCCTCGGTTGCTACGTCACGTACATGACCGGCAAAGAG
CTGTTCGACCCCTCGGACAGCGAAAAGGCCTTCCCGTTCTGTCACGCGGATTTCGAGAATACCGTCTTCTATAACTACACGGCCGAACA