Description :
From Genome Similarity Track
Location :
Scaffold_196:6645- 8730
Transcript NameFunction/comments
Physo_144534reverse transcriptase

Sequence
2085 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGTCAACGAACAGACGTGCCGTCTGTTTCGCAGTCACTTCAGCGGGTACC
ACAGCAAGATGTACCATCTTGCTGAAGCGGTCAACAAAGACCACAATGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACA
TATACTGCCAACACTCCGACGGAGTCGGTAGTGACTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCGTCACACGTCGACAAACCTCGCAAGCACGGACGTA
CTTGCGCACCCATTTATACTGGTGGCCCAGTAGAAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCCGCAGTCGGTGCATCGTGAT
ACTCATACATGATCCTGAGTCGCAGGTCGTGGTCATTGGGAACGACAACACGGTCCGCGTTGTCATCGACTGCACTGTAAAGTAATAACCCGTCGTGCAC
CCGATAACGGTGTGCACGAGCACGAAGATGCTTCGGCAGCTTCTGACGAGCTTTGTCAGAAGGCGCTGAGCCATAGGTCAGCAAGAGCTTCGCGTCCGCG
TCGTGCGCGTACGCGACCTTCACGTCGTCCAACAGTGACGACGTTGGGGTGCTCGATCGCACGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGT
AGTCAGGTCGACGCGAGAGCGCGTCGGCCACCACATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGC
CATCCGTTGCGAGATGTGCGGCGACTTCACAGCTGTCCGCAGCGACGTGTGGTCTGTGTAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAAC
TTCGCGAGTGCGTACTTCATGGCAAGGAGCTCCTTGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGAT
CACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCGCACACTACGTGGAACGGGCGATCTTGGTCGGCCACCGCCAA
GATCGGCACCTCAGTCAAGCCCCTCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGTGTCCTTCTTCAGGAGCTGTGACAGC
GGGCGTATCATGCCCACGTAGTCTTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACT
CATTGATCACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATGTCGCTCGCCCCGAAGATGCACTTCTT
CAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGTATCTCAACATCGCTCATCCCGTCCGCAGCCCGGCTG
TGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTTTTGAAGGTCGCAGGGGCGTTCTTCAGAC
CCTGCGGCATCACCAGCCACTCCCAGAGCATGCCGCTCGTCGTGCTCACTGCCGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAGCCCATC
GCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTC
AGCTTGTTGTATGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGACTTCGATT