Description :
From Genome Similarity Track
Location :
Scaffold_64:66435- 67751
Transcript NameFunction/comments
Phymu_g3208hypothetical protein PHYSODRAFT_479774

Sequence
1316 bases(100 bases per row)
ACCCCCTCATGTGTTTTCCATTGCTGAGGGGGCCTACAGATCGCTACGGAGACGACTGCGCGAGCCTGGAGAAATTAAAACGAATCAGACGATCCTTGTC
AGTGGGGAGAGTGGGGCAGGGAAGACAGAGACGACCAAGTTTATTATGAATTATCTAGCGGAGAGCAGTCGGGAtacaaccagcagcagcaaacggaAGC
GAGCGATCAGCGGCAGTGAACTCATGAGCGCGAATCCGATCCTGGAGTGCTTTGGCAACGCTCGGACACTGCGGAACGATAACAGCAGTCGATTTGGGAA
GTTTGTGCGCATGTTCTTTGAGGGACACGACCTCGGCGCCTCGTTGCGGATGGTGGGCACGTCTGTGGAGACGTATTTGCTGGAAAAAGTGCGTGTGGTG
CACCAGAACGACGGAGAGCGGAACTTCCACGTGTTCTACGAACTGCTAGCAGGTGCAGACGACGAtatgaagaaggagctgcatcttgaCAACATCTCGG
CGGAAGAATTCCAGTATATTAACGGTGGTCAGTGCTTCCAGAGAAACGATGGCATCCAGGACGacaagcagttccagttggtgctgcagtcgatgaAAGT
TTTGGGCTTTACGGATGTCGAGCAAGCAGCTATTTGGAAGATCCTGGGCGCCTTGCTGCACCTCGGAAATGTGTTGTTTGTGTCTTCGtgtgacgacgag
gaagaggataATGGAACTGCGTCGTCGCCTTGCCAACTCGCATCCTcctcgccgtcttcgcttACAGTACAGGGCCATCTGGATATCGTATCGAAGCTGT
TTGCAGTggatcaagaagaactggttTCAGCGCTGACTACGAGGAAAATCAGCGTTGGAGGCGAAACGTTCCATTCAAATTTGAGCCTCGCGCAGTGTGG
AGACGCCCGAGACGCAATGGCGCGCTCGTTGTATGCGTTTTTGTTCCAGTTTTTGGTCTCAAAGGTGAACTCAGCTTCACCGCAGGTTGGGCAAACCACG
AACTCGTCAAGTAAAACGACAAACAAGGATGCTGCGGCGCCTTGTATCGCAGTTCTTGATATCTTCGGGTTCGAAGAGTTCGAGATCAATCAGTTCGAGC
AGTTTTGTATCAATTACGCGAACGAAAAGCTGCAGTACCAGTTTATCCAGGATATTCTCttgacggagcagcaggcacACATCGAGGAGGGCATCAAGTG
GAATGCTGTCGACTACGAAGACAATTCCATGTGTCTGGAAATGGTCGAGCAACGCCCCAGCGGCATTTTCTCGCTCTTGGATGAGGAATGCGTGGTTCCA
AAGGGAAGCGATGCAG