Description :
From Genome Similarity Track
Location :
scaffold_70:66432- 70075
Transcript NameFunction/comments
Plaha_PHALS_03259Cdc4 and related F-box and WD-40 proteins
Plaha_PHALS_03260Tetratricopeptide TPR1

Sequence
3643 bases(100 bases per row)
ATAAAGAGAGGCAAAATATATCATGAGCTACAAAAATCGGCGAGGAGAAGGCTTTGGTGGGCGCAGCCGTGGCAATCGAGGTGGACGGGGAGGATACGGT
GGTGGACGAGGTGGATTTGGTAGTGGGTCATCGGTGGGCAATGAGGTATGCCGGCGTTTCATGGACGGTGGCAAGTGTGAATTTGAGCAGACGTCAGGAG
GTCGACCATGCCGCTATCCACACTTTGTCAAGACCATCGGTGAAACGCGTGGTCACAGTGGATCCATCAAGGATGTGGTTATGTGGACAGAGCGGCAGCA
ACTATTTACTTGTGCAGCGGACGCCTGTATTAAGCTTTGGGATTGCGCGACCTGGCAGGAAATCACCACTATAAGCGTGCAGGACGTGTTGCCGCCGTCG
GCCAAAGCTAGCAACAACAATGGAGGCAGGAAAGATAACAGAGACAAATCACCACATATGGAAGGAGTTACATCACTCGTTCTTTGTGGCCCTTTTCTCT
TTGCGGGCTTCGAAGGCCGCTTTCCGTTTAACCCCAAGGTGTCGGTAGGCATGATGCGAGGATGGAACCTTGAAAATCCGCAAATTCCACCCTTCGAGTT
CGCAGCATTGGATGGTACACCTTTTGCACATACTATGAATGTACAGGCGGTGGCAATAGCGACTGACCCGATGGGCAATGCCACGCTTTTTAGTGGCAGT
GCCGACGGTTCAATCCGATACTGGCAATTGGATACAGCCACGAATCAATTTAAGTGTCTTGGTGTCATGGATCGACATGTGCGTGGAGTGACGCGACTGA
AGACATTTGCAGTTGGGGGCGCTTCCATTTTGGCCTCAGCGAGTGTAGACTCAACAATTCGACTTTGGGACTTGGCGACATATCAATGCGTGAAGGTCCT
GTCTGCCGAGGAAAATGGTCACATAGATGCTGTGATGGACCTCGAGTTTTGGGTGAATGGTAACGAGACGTTTCTGATTAGTGGTGGATTAGATTGTGAG
GTTATCGTCTGGAGTCTTACTCCACCGTTTCAGCAGCTTTTCAAGGAGACGCAGGACTCGCAGGTCACTGCGCTTTGCGGTACGCAAGATGCTGCTCAAG
CACCGATCCTTCTAATTGGCATGGTGGTATGTCACTGCTTTATGTCACTTTGCATGTGAAAGTTGTAAACTCATTGTGCTATATTGTGCTTGCAGGATGG
CACTATTGCAGTCAAAGAGTTGCCTTCGTTTGCGTACAAAACGACTCTTGGCGCTAGTTTGAATCGTGGCCACCAAGATGCGGTACgacgcataactact
ggtccAAGCAATACGTTTTTTTCAGCTGGCAACGATCGGAAAATGATTGCTTGGCAGATCACAGGTGACGCTGCTGCTATTCAGTATAAGTGAACGATCG
AATGGTGATTTACCAGACAATGCCATCGCTGTCGGGCATATTCAGACTCGAGGCCCAAGAGGAATAACATAGACCATTGGTGTCTCGCTCGACTGATCAG
GCGCGTCATATGTTCTTTAGCCAGTAAGATTAAATATTTGCTTTATTTGAGCAACACTTACAGCAATAAATATCGTGAATAGCTTGCTCAGTCGCGACGC
TATGCGAACAGTAAATCTGTTATCTTTAGTAGGTAAATATTCTAGCAAATAACCGTTCATTGTGTAAAAATAGCAGCTACAGCCTGCGTTTGATGGCGCA
GATGCAAGCTGAATATATATTTACGAAATGTCGACGCCAACGATCCAACAGGCGAGCATATCTTTTCATTCCGTGGTCGGTCAAGGCAAAAAACTTTGTG
ATGTAAGCGGAATATTAGCAACGCTTTCGGTACTCCTTGTAAGGGGCTGAACAGTAGTCTGACAAGATACAGCACTAATACTGTCACCTTCAATGCCTAA
CTccttgtttacacgctggAGCCAGGTAGCCGCTTTTTGGTACAGATTGTTGAGTGCGTAGGCCTCTTCAAAACATGTTGCAGCCAGCTTTAGCTGTTTC
TTACTGTAATAACACAGACCCATGTTATGACTCGTGACGTGGTGCTTGCCCATTTCACGTGCAGACAGTGAATAGTACGCCAACGCACTGTCATACTCGT
GCAATCCGTAAAAGAGACGGCCAATTTCAAAGGCAATATCTTTTTCTTTGTCAAGAGCATAGTAATTCTTCCAGACAAGTGGAATGCCGTACATCACGTC
TTGCTTAAGTTTTGCTGAAGCAGTCGGTGACTGATCCAAAAGAATATCTCGGAACTTGTAAAAAACGTCAGGATCCCACCCGCTCAGTTTCATCAAGGCA
AGAATCGCCTTGAGCGACGGTGCTTTGGCATCTTCTTTCGTAGTTTTCTGCATCACAAAGAAGTCATTGGGTCCAAAAGACACAATCTCATTTGCAAACG
CTGCCGAGAGGTACGGAAAATGAAGGCTGCGCTTCGAAAAGGACTTGTCTAGTCCGTCTGCATATAACTTAATCATAACAGAGTCATTTGCTTCATTTTC
ACCCAATGCATTTGCTGGAAGCACAAAGGCGGACACTTTTAAACTAGCTTCTTCCTCAGGACTATGCAATGCGAATCCACCACGACTTGCAAAATACACA
CCAATAGCATGGTAATTGACCATAACTGAAAAGCTGCCATGCACGGCGATATGAGGGTCGCTGATGCCGCTAAAATGGTCAGGATTGCTGTGCCCCTTAT
CACCAGAAAGCACAACAAGTCCATTCTTCGACAGAGCTGCTAGACGCTCGATTGCTGACAAAGCTCCAATGGGGACCAATAGTGTAGCACCTATTGATGC
TGGATCAAAGTACTCGTGGTACCATTTCAAAATGTTGTTGCAGTGTGGTCTTGTCTCACCATAATACACTTCGTCGATCTGTTCGTACTTGAAGTGGTTA
TCTAAGCGTTTAATGATTTCAGGGTCAAGTGGATCAGGTTCCTCTGCGCGCTTCGATCCAACACTAATCAGTCCTTCCTTCAGAACCCCTCTATCCACTT
GAAAGAGGTCGTGGTATAGCGTATCAAAGAGGTAGTTTGCAATCAAGCACAACGGATTACTTAGCTCAGCGGGACCAATGACTTGGCCAGACGAGTGCAA
TCGCAACTCGGTGTCTGTGGTGGCGTCAAAAATTGCAAAGTCCACAATTCCACGTTTCATAAATGGCACAAGAGCAGGATGAGACTTCCAAAAGATAAAA
TTTTGTTCTGTGAAGTCCGTCATAATGTAGCGTATCTTATCCAATGGAAAGTCAAGTACGCTCTGTTCAAAGTCATCAATAGTGTAAGACTAATTGCGAG
TGTTCCATGGTGATACAGGTTTTCAATTGCATAAACTCACCTCCAATTGTGTAAGTGCtcttaaaaaataaaaactgAATTTACCAGAACCAGCACCAAG
TTCAACGATGTAAAACGGCTCCATGGTACTCACTGGTGATGCCGATCCAGGCTTCAGAGCGTCTCGTATGTATGCACTCAAGACATTGATATATCGCTTA
GCGATAAAAGTATTAGACGTGATGAAGTGCGGTACAATGCCTTGGGCCCAAGACTCCACGCCCTGGCGGTCGTAAAAGGACATCATTAGCTTCCAAAGGT
GGCAGCGAGCAAAGGGTGTGAAGTCCTCAAGCTGGCAACGCTT