Description :
From Genome Similarity Track
Location :
Scaffold_154:6643- 9947
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_154-snap-gene-0.25Ankyrin 2,3/unc44
Pytul_var.sporangiiferummaker-pug3_contig_154-snap-gene-0.18Exocyst complex component 4

Sequence
3304 bases(100 bases per row)
CCCTGCCGACGCCGCGTCTGGCGTAATCATGTTAGCAGCATGTCAATGTCAATGAGTCGATTCGCTCCAGAGTCTTAGTTCGTACCTGTGAAGAGGTCTT
CAATGCGGACCACGCTCATCCGTCCCAACAACAACACTCTTGCAGTCCAGAAAACTCAAGCAGAGACTGCGTCGTTTCACGATCAGATTAGAGAGGGTTT
ATTTGGAGCGTGACCTTTCCGTGTAATATGACAAGAACAATCGATATCCAAGAGCCCAATTGGAGCCCAAGATGAACGGCATCGACCCCGTGTTCTTCGA
CAAGAAGTTCAGCGTTGCACGCTACATGCTGCGCTACGTCGTGGGCGCGTCAACCGACGACCTCCGCCACGAGCAGCTGGTGCGCGTCACCAAGTTCCGC
GAGATCGCCGACAAGGAGATCGCGGGCGTGATCGACGAAAACTACGCGAATTTCAACACCAGCCTCGCGCGGTTCACGAGCATCTCAAACCAGTTGGAAG
GTAGTAAAAATGATTTTCTGCTTGTAAGCTCTCGGTGTGGACTGATTACTGACAGGTGAGTATGGCGCTGCCGAATACAGAGACGCGCGAGAAGATCCGC
GAGGTGAGCACACGGTCCACGGATGGGAAGAACATCCTGAGCTCCAAGACCAAAAACCTGCGTGAGCTGCTGCTTCAGAAATACGAGGCCAAGAAGGTAC
GTTATGAGCCCTCAGAGGTATGTCTATTGATGATGGAAAGCTCTTTTATGCATGTGGACGCTCGTTACTAGGTCATCGACATCATCAATGAGATCCAGTA
CATCGAAGCCGCGCCTGCGAAGATCGAAGCGATGATGAGCGAGCGCAACTATTTGGGAGCTGTCGACATGTTCACAAACTCGCTGGACCTGGTGTTCAGC
GACAAACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGAGCGTGCGGAACGCGCTCATGGAGTGTAAGCAGACCATCGAGGACCACCTCGT
GCACGAACTCCACTACATCATCTACTCCAAGGTATCGATCTATGCCTCTATTGCCACGGCGGATAGCTCAACTGACGCCACTTTGTACGTAGGGAGCGTT
CGCGCACTTCTCGAAAGCGAACCAATACTCGCTGGCATCGATCGAGAATGAGCTAAGCAACGACTCGTTTCTCGACAACGAGTTTGACAAGCACATGTTC
CAATCGAACCAACTCGACAACGACCGCGGGAGCCACACGTTCGCGAATGCATCAAATGCGTCGCATAACGCTCTTGCAGCCTCGAACCCACTGGAAGCAG
CTGTCAACGCTGTCAAAAAGTGCGCTCCCCTGCTTCTACTCGTCGATACTCCTCTGCCTTCAACATCACCAGCACGCTGACGTTTTCGTTTTCAATTAGG
CTTCACCGTGAAGTCGAGGTCATCGGTACATTAAAAACCTCCCTAGAGAACGAGCTCAACGAAGTCTTGATCGAAATTTCACTAATCTGCCGCGGGATCT
TCAACTCAAGCAGCTACACGTCTTTTGACAACAAGTTCACGGAAAAAAAGTTTGGAAAGCACGACCACTCGACCAATTTCCAGACGTTCCTGCGTTTGTT
GTTTCACGTGCTTCGACGGATTGCGCAGCGGCACTTTTTAGTCTCCATGTACTTCAACTCCAAGGGCGAGAGCTGGAACTACGGCATGCAGGAAGTCATC
TCGAGAATCTCAAGCTTGCTGGAGCGGGTTCTAGGAGAATACTTGGAAGAGACAGCGCCAGCAGAATCTTCTGGGGCGGTGAAAAATACGAAAGCAGCTT
CGGCTCCTGAAGAATTATTCAAACTGAGTCGAAACAAGCCCTCGAAAGACAGCAATCTGGGGCGCTTGACTCTTCCTCATGACGCGACCGGCAACGTGAT
CGAGGAGTCGCATACTCGAGTCTGTGAGCCGAGCGTCTTCCATTTACCAGTCGTGTACGACGACCTACAGCTGATCTCGAAAGACCTGCAGCAGTTCTTT
CGCGTCAACAGCACGAGCTCGGGTTCGGGATTCAACTCGTTCTTGAACCAGTTTATCATCCAGAAATGGATCCCAAAGGTCAAAACGAAAGCACAGGTAT
GGCTCACTGCTCTGCTTTAATTCCTTCTCGACTCCTTGCCGCTTAGTCACTCGCAATTTTTGGTGAACAGCAATTTCTCGCCTTGAAGTACCGAAACCTG
GTCACAACGTGCCGACTCCCGCTGCCATCCGACACGTCCTACCAGCCTCCGAGCATTGACAGTCTTCTCTACATCGCCGAGGAGACTTGTGAGATGATGG
AGAGGATGCCTGACCACGTTCTCGAGCTCATGGGCGTGCTAGACGCGACTGTACTCAAGTGGCTGGAAGACTGCACTGCGATTGTGCGCGATATTCGAGA
TCCGACGATCAATCACCACCAGATCATCCAAAGCGTGTCGTTCTCAGATCTCATCGCGCTTTTCCATCGATACGAAGGCTACCAACGAGCGAAAAAGGCC
GGCCCGATCCCGTATCAGCAGTCCAAACTCAAGCCAGCATCGCAAACCGCGCCTTCTTCTTCGGCTTCTTCGTCATCCACTGATGAAAAAAAATCTCCAG
CGGATGTGATCATGGAGAAAGAGCTAGAGCTGGAAAGCGAGTTCTACGACCCGGATTCGTGGACCAAGGGCACGAAGGGGCTGCTCATGGACAACTCGCG
CATCGGGATGCTCGCGTACGTCAACAGCGGCTGCGATTTCATCGCGCAATACTTGCAAACCGTTGGAATCAAAGACAGTCGCTCAGCATCGGACACGAAG
CGCGAGTCTTCATTTGGGCACATTTCAGCCGTCAGTACACCACCGCCGATCGTCCTTCAAGCTACAAGCTGGCGCTGCAGCGCGTTAGCAGACGAGTGTC
TCTTCTTCTTGCGCCGCGAGATCCGACTGCATTGCTTCTATTATCTCACGCAACTGATTTCGCAGCGGTACGATTTGGCCGAAGAGCAAGTCACCATGGC
GCAGGATAGCGTGCTCTCTCTCAACATCAACCTGTCGTCGATCGAAAATGCACTACAGCCGTACTTGTCAAGCGACAAGATGGCGCTGGCGTTTGACGGC
ATCGATGCACTCTTGGCCAACATCCTGATCTGCAACTTGAAGCAAATGAACGGCTGCAAGTTCACGAAAGGAGGGGTGCAGCAGATGTTGCTCAACATTG
GCGCTTTGCACCAGGGCTTGACTGGCATCTTGTATTCGTATCCGAGCATCGGCCGCACAGGGTACCAGTTTGAGCATGCCAAGCGCTACTACCAGCTGCT
CAAC