Description :
From Genome Similarity Track
Location :
Scaffold_1:664208- 674827
Transcript NameFunction/comments
Physo_322272Hypothetical protein
Physo_478900DOT1-domain-containing protein
Physo_322274Hypothetical protein

Sequence
10619 bases(100 bases per row)
ACCAAATGTAAGTGCTGTAGCGGCTTCGGCATCGTCTCCACAGTTACGTTGACCCATGCAAACCCCATAGTGACGGTCCGAACTACGGTACACGGCGACA
GTGGTGACGCCCATCGTAGATACACTGCTGCCAAGTGCCAATGCCGCCTGCGTGTCCCTGTCGCTGGGCAAATTGGGCGCTTGCGACGTCGTCGTCATGG
CGACTTCAGGCTCCATCTTGACCCCCGATGGGACTCGAACGCTCCATTTCTAGCGGTAGCCTCTCTTGATCTTTGTCGCCGGTGGCACCCCGCTCCCTCC
TGAGGCATCTACGTGCGGTTGTCCGTCGATGAGGATCGCTGGAAGCGAAAAAGGGCGGGAGAACGCCGTCCACCTGCAGGTCTAGTGGGCAGTCGTCCAG
TGCCGCCTCCGACGCTCCATCTCGGGGTCCTGTAGCGGAATCTCGGCGTCTCGCAGCTGAACGTGGTTGACAGCCACACCCGGCGGCAATGCCGTGAGGA
GAGTTGGGGGCTACGGGACAAACGACACCATCCCAGCGCCAGTTCTAGTAGCACTGCGTTATCGACAACAAATGCGCTGTTGCGGCGGTTGTGCGGGACG
TGGTCGTCGGGTGGGTACACGACGGACAGCGAGTCCAACTTCATGCCCGGTGCGTCCCGAGGTCAGCGCGTCAAGTAGCACAGGCGGTCAGCAGCAGCAG
ATGCGTCGACACACAGGAGCTGAGCGTGTGGCGACTCCAACGACGCTGGACTTGGAGAGTGAGGGGCGAACTGGCAGGCTGGACTTGACCGCAGCGTGCA
TAGTATCACGGGCAGCCACGCGCCGTAAACGATGGGTACGGCCAGCACATGTGTACCACCGTCGTTCGAGGCGTGGAAACCGGAAGAACGGAGCGTGGTC
AGCCAGGGACACTTGGGATCGAGCTTGCAAAATCGGAAATGAGCTCCGATGCGAGAAGGTCATTTTGATTCGGAGCAAGCCGAGCAAGCCGACCAAACAA
CAGTGGATCGATTTGAACTAATTCCACCAATCACACTTCTTGTTGAACTTTGGCAGCCAATCACTGTCATCGATTTTTCGGAGACAGGTTTTGATTGGTC
AAAGCGAAGACATGGAAAAAAATGTCAGCGCGGGAAAGCTTGAAAAGATCAACCAAAGCAAAATGGGCACCAAAAAGGCGAGCCTTTACATGTTGTGTAA
ACCACTTCAAATACCAATAGTCTATTTATGTGACATTATGTATCGCGACCGCTCTACCCGTTCTCCCTCGCCGAAACGCCCTACCATCGGCATTCCCCCA
ATCATGGTCTTGATGGACCTGGTCGGAAACGTCTCCGCCGTCGGCGACACGGATGCGATGGTGGCGGGCGACTCGGGCAGCAAGCACAACGGCGGCCGCA
GCGCCGCCGTGTGTGCCGTCAACAGCATGGTCTCGGAGGCTTCCGCGGCGACCGTGGCCGTGTTGGATGTGATCGGGTGCGTCTCCTCTGGCATGGTCAC
GAACGTGACGGTGGCATTCGGCGCGGTCGATGAGGCTAATAGGGGTGCTTTCGTGTTGGCTGGGCAGTGCCACGAGAGCGTTTATAGCAGCGGCATCGAT
AGCCGGGCTTAGTTGCCTTGCTGGCGGTAGGAGCGTCTTGAACCTGGTGTTGAGTACATTGATGGGGATGGGACCTTTGTGAAAGGTCGGTAGGTTATCA
GGCGAAGAAGTATGAGACCAAATATCTTATGGTATGTATGGCATTATAGATTTCTAGATCTCGTGGTAACCCGATGGCAGACTTCTCGGACGAAGAGGAC
TTGCTGCTTTATCGGCTGGCAAAGGAGCAGGTTGATGCAGGCCGCCGAATTAACTGACGGACTGTCTGGTTGGGGATGCCATACTGCGGGAAGACACAGC
GACAGCTGCAGATTCGTCTAAAGACGCTGAAGAGGACACACGGCGTGAGCTTAGATTCTTTCCCAAGGAGATTTCGGGATCAAAAATCGGCACGGACGCG
CTTAGTGGTGGCCACAAGGTGAGCGCTCCCGATAATGTTGGCAACGTTCATGACGCTGTGTCAAGTTTGTATGCCTCGGCCTTGCGTCAACCCGTCCATG
CGCCGGATTGTCATGCTGGTGAGATTTCGCCAACTGGGGTTTCAGCAATACTGGCAGTCATTCCAACGCTTACAATCGCCGAAACTTTTGTTGAATTTGG
ATCTGGGATCGGCAACGTGGTTGCACAAGTGGCATTGGAGACTTGTGTTGGGAGATGCATCGGGATTGAGTTCCAGGACAACTTGGCAAACATGTCAAAA
CTGCTGATTCGTGGCGCACGCGTGGATTTCCCGAATTTATCCAAGGTCACGATTCACGAGGCCGACCTCAGAGCGATGAGCCCAGCCGTACGCGAGGATA
TTGACGGGGGCAGTGTTTTATTTGCGAACAATATCGTTTTCGAGCCTACAAGTTTTGCGGCGCTGGAGGACTTTGCATCTTCAGCAGCAGGTTTGGTCCA
CGTCGTTGTCATGGCAACAATTTGCGGCGGGCACCGCCCAACCTGCCCGCGCAACTTCTGTTCTGTCTGGACACCCCGACAGCGTATCGACGTTCAAGTG
TCTTGGTCTTCCCAGCTTCATCACGCATACTGGTACACCAGGGTTGTAGAGCCCTACATCTAAGTACCTCGCGCAGAATGGAAAGGGACATTCAATATAC
TTCGTTTGTCAGACATGTTCATCCCACTGTTCATTACCTGTAGAGCCAATAACATATATCAGCCATTGTACACATCTACATCAACGTCTTGCACGGACAT
CGTAGCTCTGACCGCATCCCCCAAGGTCAGAGTCACCTCCATCGTGTCCGAGACCCTGCTGTCGATGTCGCTGGCGACGCCGCTGACGCTACTACCGGCG
GCAACCTGCGTGCGGACTGCCGCTGTCGTTGCGCTCGCTGCCCGAGCCGAATGCCACCGTCGCGTTCGTGACCATGCTAGCGCGGCCACGGTCGCCGCGG
AAGCCTCCGAGACCATGCTGTTGACGGCACACACGGCGGCGCTGCGGCCGCCGTTGTGCTTGCTGCCCGAGTCGCCCGCCACCATCGCATCCGTGTCGCC
GACGGCGGAGACGTTTCCGACCAGGTCCATCAAGACCATGATTGGGGGAATGCCGATGGTAGGGCGTTTCGGCGAGGGAGAACGGGTAGAGCGGTCGCGA
TACATAATGTCACATAAATAGACTATTGGTATTTGAAGTGGTTTACACAACATGTAAAGGCTCGCCTTTTTGGTGCCCATTTTGCTTTGGTTGATCTTTT
CAAGCTTTCCCGCGCTGACATTTTTTTCCATGTCTTCGCTTTGACCAATCAAAACCTGTCTCCGAAAAATCGATGACAGTGATTGGCTGCCAAAGTTCAA
CAAGAAGTGTGATTGGTGGAATTAGTTCAAATCGATCCACTGTTGTTTGGTCGGCTTGCTCGGCTTGCTCCGAATCAAAATGACCTTCTCGCATCGGAGC
TCATTTCCGATTTTGCAAGCTCGATCCCAAGTGTCCCTGGCTGACCACGCTCCGTTCTTCCGGTTTCCACGCCTCGAACGACGGTGGTACACATGTGCTG
GCCGTACCCATCGTTTACGGCGCGTGGCTGCCCGTGATACTATGCACGCTGCGGTCAAGTCCAGCCTGCCAGTTCGCCCCTCACTCTCCAAGTCCAGCGT
CGTTGGAGTCGCCACACGCTCAGCTCCTGTGTGTCGACGCATCTGCTGCTGCTGACCGCCTGTGCTACTTGACGCGCTGACCTCGGGACGCACCGGGCAT
GAAGTTGGACTCGCTGTCCGTCGTGTACCCACCCGACGACCACGTCCCGCACAACCGCCGCAACAGCGCATTTGTTGTCGATAACGCAGTGCTACTAGAA
CTGGCGCTGGGATGGTGTCGTTTGTCCCGTAGCCCCCAACTCTCCTCACGGCATTGCCGCCGGGTGTGGCTGTCAACCACGTTCAGCTGCGAGACGCCGA
GATTCCGCTACAGGACCCCGAGATGGAGCGTCGGAGGCGGCACTGGACGACTGCCCACTAGACCTGCAGGTGGACGGCGTTCTCCCGCCCTTTTTCGCTT
CCAGCGATCCTCATCGACGGACAACCGCACGTAGATGCCTCAGGAGGGAGCGGGGTGCCACCGGCGACAAAGATCAAGAGAGGCTACCGCTAGAAATGGA
GCGTTCGAGTCCCATCGGGGGTCAAGATGGAGCCTGAAGTCGCCATGACGACGACGTCGCAAGCGCCCAATTTGCCCAGCGACAGGGACACGCAGGCGGC
ATTGGCACTTGGCAGCAGTGTATCTACGATGGGCGTCACCACTGTCGCCGTGTACCGTAGTTCGGACCGTCACTATGGGGTTTGCATGGGTCAACGTAAC
TGTGGAGACGATGCCGAAGCCGCTACAGCACTTACATTTGGTAGCAATACTGGAGTAAATCTAAGTACCGTATGTTACCGTTGAACGCTTTGAGTACTCG
TACTATTCATGACTCTGTGTAATTACACTGTATTCATCCCGCACTCGATATCCGATGAATTTTGCACGGTACCTTATCAGCACAGCTACGCTGCATTCCG
CATGGCGGGCATTGAACCTGCACCGGTGGGTTCAAACTCCACCATACTAACATCACATACAACGATGAGTCGAACCACCCCATACAAAGCCTAGTACGTT
CGGTCCCTTTGAACACTTCGAACATGGCCATACAAATAACAATATATTCGGTCCAATGGCTCAAGCGAGACCGATGCATGCAAACCAGTTAGAGATCTTT
GCCGTGAAGGAGCCACTGGTACGCTAGCTGAGCTCGTCCACCACCACATACCCAATGCCACGAAAGCGGAAGCAGCGGTCGAGCACCTGCGAGCCAACAG
CTAAGCGACAACAATCACGACGCTCGGGTCGTATCTCACCTTCAGCTCCCACCGGTCTAGGTACGATCCGTTGCTTACCTAGCGCTCGAGCAAGGTATCA
TATTGACGCGTATCCACCGGCATACAGACCTCGCGGATGACCATGCGATGTTTGGATCTGTTTGGCGAGTTCTAAGTGCGGCTGGTTGGAGTTCAAAGCG
TCCAACAGGGCGAAGCTTGAGTGATCTGTACCGCTATATCCGTCCCGGTGGTGACTCGAATGGAACAGAGGGTATCGACTATTATCTGGGTGAACGAGCG
CTTTTGGAGCACTATCGGCGGACATTGGTAGTGGAGGATGGTGATACGGATGGTGCCCTGTCCAGGCGACCCGATGACGAAATTGATGTCGACCAAAACA
ACGTTAATATATGTGGGGCTGGCGATGTTGGTCTCAACGCGGCAGATGATGTACGTGGTAGTAGCGGCGGAGTTCCTGGAGCGAGTGCAAACGACGTTGA
TTGTGAGAAAGCCGCGCTTCCGGGAGTAAGCTGTCACGAATCGGTGTTTGATGGTGCTGCCAGCACCTCTCAGGATTATGATGGTGCTGCCTCTGCTGTA
TCTACACCGCCAACATCAGCGCGCGTCGTACCCGTACATGCAGCAGCTACGCGAGACCATTTACTCCAGCTAGATCACCACGCACCCACCGCATCGTCTG
GTACATGTGCGCAATGTGCAGTCTGCAATATGGAGTGTTCAACCGAGCGCAGTTGTACCTGGTGCAAAAAATTTCTCCATCACTTCTGCTCTCATGATGT
CTGCGTTTCGTTGAATATCCCAGACCCTAATGGTGGATTCGCCAAGGATTTCGGTGATAGCAGCTATTGCAGCACGCTTTGCAACACAAACGCTACAAAA
ATGAACTTGGTGGACCAAGGGAGAAGTGATGAACGACCCAATGCCCTACTTGACCTCCCCGCGAGTGTTTTGACGCCAAGTGTGGCTCCGTCGGAACCTG
CAGAGACCAACGCCGCCACACCTCCTGCTACAAATTGCTCGGGGGCAGCAAAACCTTTAAGCGAAAAAAGCGTGGTCCTGCCGAACAATCAGCTCCAAAG
GCACCCCGAAGCGAAAACCAAGCTGCGCAACGGAAAACGAAAAGCAAGAAGGCACCTACCAAGGCCAGCAAACCCAAGGCTGTGGCAATGAAAGAAGAGT
TGATTCGCCGAGCACATGCGGCTGCCGAAAGATTTGTTGATGCTAGCGTAGCATGTTCACCGGCTGATGAGGAGTGGATGCCGCTCAGTTTGTAACGCGA
CGTTGGCGCAGCATTTTTGATTAGTGTGGTGACTCGCTACAGCCTGGCAAGCGAAAAATATTCTGACAATGTTAGCGTTCCTCACGACAAATTTCAGGTT
CAATGGACGTGTACTGCTTTTCAAATAAAAGATCACGTTCACCACGTTTCCGAAGCCATCATCACCCGTGGTATCCGCCAGTTTGCCAACATGGAAAAAA
GACAAACTTCAATTTGGAGAGTCTTGGACGTCCCTGTGCAACATGGTCCCCAAACTATCAAACATTCCTGCACTGACAGATGAATTTGAGGAGATGGACG
AGCGTGGTTATCGTGAGTGGTTTGCGTTTCGCGGGCGGAAAGAATTGCAGCGCCCTTTGTGCCCTGGTGAAGTCGAAGAGATAGCGTCAATGACATTTTC
ACCCACAGCATCGCTTGGCCAACCGTCAGGGCTATTTACACATCCGGATGGGATCCTCTGGTACATGACTCTGTTCGACAAGGGTGAGATGAGAAATTAC
TGGGTGGACGACGAGGAAGCAACTATTTTTTCCTGGAGCGCGTACTACTAGTTTGAAGTCAATTATGACATGGCGAAGATTCCTGTACATCCGTAAGAAT
TTGAGTTTTCGTTCCAAGGTGTCTACCTCCGACATCAAGCGCGGTCCTGTAGCTAGAATACGACCACTCATGAGCATTCTGAAATCGCGATGCCTGCGCC
ATGTTGAAGTCGGTCGAAACGTGGCTGTTGATGAGGCCACAATTGCCTGCCGATCCCAGTACGCCCGCCACATTATAGTCTTCAACCCACAAAAACCCAC
CGGAAAGTATCATTTCAAGTTATACGTGTGTTGCTGTTCTACCTCGTGGTACGCGGTGAGTTTCAAGTTGCACTGCTCCAGTGAACTTGATGATCGGCTG
GACGGTGTAATTTCACGCTCAGAAGTGCAGAAATTCGCTGATCTAACCGCGAAGTCGTCTGAAATCCGCTCTCACGTCATGGCGGTTACTTCATCTTTGA
AAGGATCCAGTCGCATTGTAAACACGGACAACTTCTACACTTCCTGTTTGCTGTTGAAGACTTTACGATCGATTGGTCTCTATGGGCGTGGCACTGTACG
CACATCTAGCAAGCATTTCCCTCATTTTACGATGATTCGTAAGGAGGACGCGAAGCCGCGAGGCTACATGAAGCAAGGTGTATGCTTAGAGAAGCATATT
GTGGGTGGATGGCTCAATTGTCAATGTCGTGTCTAATGCCGATGCTTCGACCACATCAACTGTGCATCGTCGTATAAATGAATCGGGTGTGGCTTTCACT
GCTCCTACTTGCGTCGGCGAGTATAATTCAGCGATGCATGGTGTTGATCGGCTCGACCAACTGCGTGCACGATTTTCTCTAGCCGATGGCCACTCATTTC
AGAAGTGGCATAAGAAACTAGCGATGGTCATGCTTGATATAGCCAGGTGCAATGCCTACATTTGCGATAGTTTGGCGCGTGGTGAGAGCGAGGAGTCTCG
TTCGACGGGAGGTACAGCCCAAACGAGGTCAAGGGCCCGCGATAGTCATCGCGCATTTGTGGCATCACTGGTTCGAGAACTGTTCGATGGGGACTGGAAG
AAATCTCTGGATAGGGAACATGGAATGATGTATGCTGCGAAGCCGACAACGACAACAATGCCGATGACGACCCAAACCGCGGCGTCGACAGATGTATCCG
AGTCTTCGGGCGATCACGCACAAACGTGTGTTGCAAGAGCGTCCTCGGAGGTGCTTCAGGGAAGGAGTCGCTCAATGCGGAAATGCACTGTGTGCAAGTT
CGAGGGCAGAGATCCTACCGAGAAAACCGACTACTGCGAGACCCATCGAGTTGCGTTGTGCAAGCGCACATACCCTGTTGACCCTACGAAGCAGCATCTG
TGCCAACAGCAAACTTGGACTTGCTGGCAGAAATACCATTTGTTTTACTTGCCGAAGCAAGTGTACACTGTCGACGGCAACTTGCGACGAACCTCTCCGA
TTTATGTAGCTAACCGCCCATTTCTGAAGGCCCGCCAAGATCAAAAGAAGGCTAACGCAGCCACCAAGGCGTAACCTCACATCATTTTTTCAAGATAGTC
AAAGTCAACTAACCATTTATACTTCACTGCACTAAGTCACACCTATTCCATCTGCCCCCGCTAGTCTTGATGCCGTAAATCCGGATTTAGCTCGTGGCTG
ACAACATACTGCTTCACCACTGGTGCACCATAGCGGCAAGCTAACCACACTCCACTGCGTATAATCCGACAGGATGCTATTAGAAATTCCACGCGCCTCC
AAGCCGAACAATAACTCCCAACTGTGTATATGTCAGCGAAGACGCCTCAGACCACATCCAGCACGGCCACGTTCGCCACCACCACATCTGAGGTCATGCT
GCTGACGGCGCTGCCACGGCCGCTGCCCTCGCTGCCCGAGTCGCCCGCTACCATTGCGTCCGACTCCATGCTGACGAAGTTGCCTCCGATCTCCTCCCGT
ACGGACACGATCTCTACAAAGGACGTCATGCTGTTGATGCCGCTGACGGTACTGCTGGCACCTCTACAACGGTCTCCTTCCGCACTGTCGATGCATTTGC
GCACGCTGTCTGGTCACCGATCACATCCTTGCCAACCTCCGTGCCGGTGGAGGCACCCACGACCACCTCCAGCACGACAACGGTCACGCCCAAGCGTCCG
TGGTCATGATGTTGCCGGCGCACACACGGCGCTGCGACCGCCGTTATGCTTGCTGCCCGAGTCCCCCGCCACCATCGCGTCCGTGTCCGTGTCCATGTCG
GCGGAGACGCCCCTGACCGCGTCCTCCAAGGCCACGGTCACCTCCATCGTGTCCGAGACCCTGCTGCCGATGTCGCTGGCGGCACTGCGGCCGCTACTTC
CGGCGGCGACCTGTGTGCGGCTGCCGCTGGCGTTGTGCTCGACGATCGCATCCGTGCCCCTGGGGACACAATAGTGTTGATAGATATACTACAGAAGACA
CAATAGCGTGGGGTTTTACCTATCCCTCTTAGCTGTATGATTGGTCATAAACGGCGAGGAAACTGCCGTGGCTCAGAAAATTGCTGTTTCAGTTACTTCA
TCACCAGTAAAAAGATACTTGATGTATCATTCTGGTAACAATAGGGTTAAGCTATCTATCGTTTTTTTGGGAGCCCCGGAGGTTGCTGGGGTCGACAAAT
TGTTTCAGATAATTCATCATAGGAAGATTTCTCTTCGCCAATGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNN