Description :
From Genome Similarity Track
Location :
Scaffold_650:6642- 7662
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_650-fgenesh-gene-0.0Phosphatidate cytidylyltransferase

Sequence
1020 bases(100 bases per row)
GGCGTGGACTGGCGGCGCCGCATCCTGACGCTGGTCGTGGCCGTGCCCGCGGCGTTGCGGCTGCTGGTCTCGGACCTTGGTATGCTATTGCTCGTGACGC
TCGTCTGCGCGCTCTGTCTGCTCGAGTTCGGCGACAACATCTGTGCGCAGATCGTGTTTTCTTCTGGACGCCGAGGACTCGCCACGCGGCTCTCGCACCG
CGTGCTCATGGTTGCTGTGGGCGTGGGCGTATGCCTCGCAGCGTGGAGCGGCAACAAGGACGTGCATGGTGCGTAATGACGTCGTGGTTGCTGTCTATAA
ATGTGGATGATGTGGATACATGCCTAACAATGACTTGGTGCTGTAGATGCGGCGATGGCGCTCGTGACGCTGGTTATCTTCCTTTACCACCTGCTCCACA
CCAGCAAGCTCGACCAGCAAGGTACGTCTGCTTGAGCTACGCGTGCATATCTGACGCATAACACATAAAGTCACACCATGCTCATCGTGTGTATGTATGT
GTATCAAAATGTCCAGCGATGACGATGTTGTTGTTGGATCTCTTCGCACTACTGTTCATCGTCAGCGGTCTGAGCCACGCGATCCTGCTGCGTTATGCAC
ACAAGTACGGCTTGGGGCTGCAGATCATGGGGGTTGTGAGCGCCTGGGTGTGCGACTCGGGTGCGCTCGTGGCCGGCGCGTTCTTCGGCAACGCCAAGCT
CGCGCCTGTGATCAGTCCTGGGAAGACGCTGGTCGGCGCGCTCGCGGGGGTTGCGTCTGCTGTCGCAACTGTGTTGGCGTTCTTCGCATTGCCGCAGCTC
AACGAGCGTCTCTTTGCAGATTTTCTACCATCCGTGTCCGTTTGGAGCCAGATCGCGTTGGGCGTGGCGCTAGGCGTACTCTGCATATTGGGCGACCTGG
TAGAATCGTACATGAAGCGCGTGGCGAACGTAAAGGACTCGGGCGTGTTCTTCCCTGGTCACGGCGGCTGTCTCGACCGCATGGACAGCGTGCTCTTCGC
TGCGCCGTTCCTGTATTTCT