Description :
From Genome Similarity Track
Location :
Scaffold_857:6641- 11273
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_857-fgenesh-gene-0.0DNA polymerase epsilon subunit

Sequence
4632 bases(100 bases per row)
AACTACTCGACGCGACTGAATTCGGTGGTGTTTGTGCTCGGTCGATACAGCACAAAGGAAAAGTCCACATGGAACGGGCCAGGGTGGAACACCGCGACGG
ACGAGTAGCCGAGCTGGAACTGTTCGGTAGAGTCCCCCAAAATCAGCTGCGGCAAAGCATACAGCATCCACGTCAGCCTCGACGATCATCCTCATTGCTG
GATACACACGTGCTCCGTACCACATCAGGCAGCGGGAAGAGTGAAAGCGACGAGTCGAACGCCCAATTGACAGGATTTGCCATGAGCGGCAGTGGACACA
GGTGAGCCTGATCGATGATAGTCTTGACCACCTGCATGTCATGACGAATGTGAGGCAATGAGGCGGGATATCTACATCAGAGGGCTGCCAGATTGGACGT
ACATGTTTTGAAATATCAACTTGCTCAGAGTGGTCAGCAGCGTCATCACCCTCGTCCGTCTCCATTTGGCTCGAAATAGCGGGTAGAATCGCGTGGCGGT
GCAGTTTCTGATGCAGGTTCTCGCGGAAGATGACAATGTCTTGTGTGTAATATCGGATCCTGTTTGACACACACACACACACGCAACCCCAAACAGACAT
TAGACACTCACAACAGAAGGCTGCAGATCAGGAGCATTCAACCTGCACGGATTGGTGCTGCAAGTAACGTTTGGAACTCGTCGCATCAAATCCCGCGTGC
AAATATCGGGCAGCTGAAGTCAATACGAAGAATCAAAGGTAAGAAGACACTCGATCAGCACAATCAGCGTCTTGTTTGTTCGTACCGGATGCCTCGGGAA
GGTGCGGGGTGAGCCAGGATCGTTCGGTCCCGGAACCAGAACGAACCTCGAGTTTTCGGCGAGCTGAGGATACTTGAGGATGAGGCTGGCGAGCTCGTCA
AAGTACTCCTTGAGGTCGTGAAGCGAGTTGGAGCCCGCGCCGCCGCCGACAGACGTGGACATGAAGTCGCCCATAAGCACAAACAACGACGGCATGACGC
TCTCCAGACCCTGGAACAAGATGTCCAGGTGCTTCATCACTTGCGGGTCGTCCAAGTGAACGTCCGAGAGTACAATGAAGGTCGCGTGGTGGTCATTCGC
TTCCAGCTCTCGGATCTGCGAGAGCTGGTGCGCAGAGACTTCGACGCCGAGCGGGTCGATCGATCCAAGCACCTTCATTGACTCAGCTTTCGCTTCTGGT
GGCGGGAAACCCATCGACTGTCGATACACAACCAAATGCACTCAGTCAAACCACACCATATCCAGAGCCGAACCGAGGTCTCGAGAGAAGAACAGCACGC
ACCTGGACGTGCAGAACATCGTCGATCACCTCGCCTTCGACCAGCACAACGCAGTTAACGGTGAATAGTCCATCCGTGTAGCTCTAGCCGAGAGCAATGT
CGCGCCAGCATCGCATGTGCAGGATTAGTTTGCATTCGTGATGTGCAGACAATGCAGTAGATGCGACCTACCGCGTTGGATAGGTCGATGTAGACCCGCG
AGGTCAGGTCTTCGAGGTAGAACTGCTTTCGCTCGTCCTGACCAATCATACCAATCACACGCCGCACGCCCGTGGCACCGAGCAGTGACTCGATTCGCGA
CAGCTGGTACACAAAGTGGTTTGTCAGTTATGATACTCGGACTAGTGATCGAATCTTGAACATTCTCACCTCAATGTAGTCCATCGAACTTGCGACCGCT
ACTGACGGCGGCGTGAACATTTTGTTGCGCTTCACACGGAGATCCACCGTAACGAACCTGCTCACAGACCACGCCAACCAAACTTGTTATACATTTCTTG
CTTGGAGCTTCGAGCTCAACAAAAGTGATCGACTCACCGGTTGCGAAAGAGGTCGAGCCGCGCCTCGGCATCAGCGTGGATGTGGCGATTGGCGCCTCCC
TGCAGCTCGTACGCGCTGTTGTTCTGGTTGAAGACCAGCTGCGGGATCTCAAAGGCGTTGAACACTTGAATCGCCTCGAACTGGTTCTCCGTCGACACGG
CCAGCAGCGTATCCAACGCACTCTCGAGCGCTTCGAGGGTCACCACAGACGTCGGGACTGCCGCAGCAAGCCGCAGCATGCAAATCAGTAACGGCCCACT
GCAGGTCGTATCGTATGGCAATAGCACAATGGGCGTACTCTTGCTCTTGTCAATGTTGTTCTTGATTGCGTAGATGACGTCGTCGAGCTCCAGCGATGGC
TCGCTGCGTTTACAGAGAGCAGGCACGTCAGCAAACCCGAAGAGCTGAACAGTTGATGTGCACGATCGCGTACTTGACGAGCTCGTCCGTGAGCTTCTGC
AGCGCGTCGGCGCGCAGCGCCAGCCCCTGGAGCTTGCATGCGCGGAACACGCGCTTGGATGCCATTGTGCTAGTGTGCTCTTTCACTCGCCAATCGGTTT
TCCCGCCATAATTGGGTGTACCCACGCTTTGGTACATCGTACTTTGGAGATACACATGGCTACACTGTGTTGAAGTCGCAACAACAGCAATTGTGCAATT
GTCGGTGCTCAGAAAAGTCTATTGATCTATCGATCTACCTAATGCGCGAGGCAGACGGAGCAGTAGCGAGGTCCAGTCGGCGCTAGGCGGTGCCGTGCCC
GCCCTGGCCGAGACCGAGCACGTAGCTCATGCTCTGCGCGTCGCGCACTCCAGATGCGTCCCCCATGGACTCGAACACGCGAGAGAACTTGCTCCACGAC
TGCGCGCTCTGCGGGCGATCACACAGTCTGATCATAGCAAGCGTGTGAACATTAGTTCTACTCCGCCGGGACAACCCAGGACACACTTGGTAATACCTCT
CGTTCAGCAGCAGTTTGGCGAGTCCGAGGTCGGCGCTGCTGGCGGCGCTACATAGACAATGGGCATCATGAGAATGATGTTGAAGCAACACACCTCTCGT
GTCCTGTCGAGTTACCATTCAATCAGCAGCAAGTTGATCAGGTCACGCTCGACCGCATTTCCACCGAGCACGGCGAGATCCCCGCGAATGCGGAGCAATA
GCTGCGCCGCTTCTTCGTATCGTTCCTACTCCCCAGAGCAAGCATTCCCCCAACGTTAGCGGCGAGATTGACGCTGTATCGAATGGCAGTTCGTACCTCT
GCATAGTGCTCAAACGCTTGGTAAACACTCAAAAATACGTTGTTGATGTAGTCTGCATAGAACTCTCGTCAGCATGTCCAGCAAACATGACAACAACAGA
TTACGACAAAAACGTACCCGATGGCGGCGGATAGCTGAACTGAATTGGCACGGCATGTAGCTGGTTCTGTAGCTCCGGCAACGAAACGACGGGTTCGACG
ACGTCAAGACTGTCGGACGCCGGGATGCTCTCCTTTGTCAGCGCCAGCACACTCTGTTCATTCCAACAGTCGAGATCAAGCAACGTCAGCAAAAATACTT
GTGAACTGTCCACGATGGAATGTCAGCGATTGTACAGTACATGGCGACACAGCTTGGCGAGCGGTGGAAGGTTCGAGTGGAAGTGGTCGCCTTCAGACTT
GTCGCTGCTGGAGATAGCCGCCCACCCATCGCGCAGCTGCTGAGCGAGCTCGCTAGTGTCGCGGCCGGCGAACCGAAGGCGCCAGAACAGCTGCGTCGCA
TCGCACAAAGTCCGGTACGAGTGGAGTCGGCCGTCGCGCAGACGCGGAAAGATGTTGACCTCGAGCATCTTGTCAATGCGGTCGTAGCGGCCGAGCTCCA
GCAGGAACAACGCCCACTGGAAGTACAGGTGGCGCTCAAGCGGCCCGCCATTATCGAACGCGTCCTGGACGTTCAATGTTAGAAGTGGTTGGGACTCTGC
CGCTTAGGTAAAGCAATCGTACCTTGTATTGGTTGGCGTAACTCGCGCCGTGGTTCGCATTGGCTCGCGCTTCGAAGACGTGCAGCATTGTGTAGACTGT
TCCAGTGGCATCCAACACATGAGATCGTAAGCTCCGGCCCGAAGAAAACGTCTACATGCAGCATTCATACACGCCCAGCGATCGTTCCCGTTCATCGACA
TGGCCTTCTCGGCCAACGCCTCGGCTGCGTCCAGTCGCCCGGCAGCTTGCAGGGCATACGCTTGCATCGACAGCAGGTGGCTGTAGCCTGCAGTCCGACC
CATCGTCATCAACGATGTCTTTAGAGTCCAAATCAACACAACATCGGTCCAGCAAACTCAACATACCTGTCTCGTTCGGCGACCACGACGGAAGGCGTCG
CGTGATTGACGTCAGCATGTTATGGTGATCACTGTCAAGGAGTTGATACGAACACAGCGTCAGGCAGAGGAACCGCTACTCAGCGTTGTCAACTGGCCGC
ACCCGAGCAGCAAATACAAGTCGAAGCAGCAGCGCAGCGCCAGCAGATCCGAATGGTTCTGCGTCAAGATCGTTTCGTAGATCACCGCCGCCTCGCGGAA
CCGGCCGTGCACCATCCCGTCCAGCGCCAGCACGTGCATCTTCTCGGCCGGCGAGACGTCCGCCGCTGTTGCATCCATCAAGGCATCAGTCTTCACTCTT
TAGTTCGTTGTTACTCGACCACCTCCCCCAACCTGTGTTGGCGATCTCAACCGCCGTCGCCAGCCGCGCCTTGGCGTCAAGCGAGTCCTGGTGCGCCAGC
GGAGCGAGACACTCGCTGGCGCCGACCAGGAC