Description :
From Genome Similarity Track
Location :
Scaffold_1255:664- 3716
Sequence
3052 bases(100 bases per row)
CTACCCCTCGTGCGGTCTTCGCAGGATAAGTGGATACCTGGTTATAGTGCTCGTGTCTTATGCCCCTGGAAAATTTGCGCCGTGGTCCTCTCGCCGCTTG
GGTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTTGTTCGACCACGTTTCCCGGCTCAAGAACTACCTTTTCTGTTCCGGAACCT
CGCGCTTGCCCGCCTTTCGAGTCCCAAAGGTCACCACGACTGGTGACCTCNNNNNNNNNNTCGTCACGTTATACGGTCAGAGACCATTGAAAAATTCTGG
ATCGACCGATCGCACCTGTTTCCTTCCCCCGACTGGCTGGTTCAAGTCTTGTTAAATGTCTACCGTGATTTTGAAGATCATCATCGCCAGTCGNNNNNNN
NNNNNNNNNNNNNAATCATCGTCCAAGCTGCGCGAAGGATTCTGGGTTGAGCGTCTACTATGAAGAAAGACGCAGTAGACGTTCATGATCTAGTCCCCGG
TGGAAGGCAGTGCTTCGGATTGCGCTGCAGGAGTTGGTCGAGGGACATTTTGACCTCGACATCCTGCTAGACCCCTTCTTCCTGNNNNNNNNNNTCCCGG
ACGCTAGAAAAAATGCCTGGGGCATCCGGATTCCGGCTGTCAACAAACCGACATCCTCAATTTGGCTTCCTCCCTGCGATTGACGGACTCCGCTGATCCC
TGGCGTATTTAAATCGTAAGGCAATCGCCGATCACCCGAAATCTTCCATCGACTGACTCAAGAACAAGTTCTTGGAGATGTGATTTGTCGTTTCTTGTAG
AAAGGACCACGGTGTTTATGACCGCAGTCGTGACCTCCAGTCGTAACTACTAAATTCGCCTTCATTGTACTTCATTAACTTTTCACATTCCATAATCATT
ACGCTCGTTAACTGTGTAATTCCTCCTGATGGCCAGCTCGCGTGGTCATTGTTCTTTCCGCTCACGAACCAGACGATCACCANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTGCATCACTTCCAATCGATTCCGATTAGCGCCATCACGTTCAAATTTTT
GTAACAATGCACTACAATTGAGGTTCTCTTCATCCACACATGTTTCATCACTATGACCCTTCCACCGGACTAGAAANNNNNNNNNNGTCCCGATTGTACA
AATCTAATACTGTCCACCTCGTATTGACCTTCAGCCAAATTGTCTCCCCAATTGTCCTCCGGCAGTAGGGCTTTATCGAAATCCACTCTTTTGGTTTCTT
CCACCTCCANNNNNNNNNNNNNNNNNNCCGTGCAACAGGTCTATCAAGAATTTTTTTTACCAATTTCAGCTTAGATATGTGCACGAGTGGAATAGTTGGT
ATGGGGTTTCTTACACTTCCAGCCATACTTCTTGTTCCTCGCACTTCTCGATCACCCGAAATGGGCCATGCCNNNNNNNNNNNNNCTGGTATATTCTTCT
TCACTCAATTCAAATACAGCCGCACTTAGCTACCACAGCTTATTCCATGTGGACCTTGACCATAGGTGTGTTGATCAGCCCTGTCCTGAATAGCCTCTAT
CAGCGGGTCATTCACGGTGACCCGGGCGCGTTGGTACGGTCGCTATATATGGTAACGCCATCTTCGCAAACAATCTACTGATGAGATGATCTGTAAACTG
GAACCAGGATTAAGGGATGTCCGAGGGAAGCTTTTACGTTTAAATAAAAGACGGACGCTAAAATTACAAGGTCAGAGTTGAGCATCACAATATTTAAGCA
TCGACGAACATGGCCGGGCACCCAGGCTCTCGTATAATGACAGATTATGGGGTCACGATCACGTGTTTTAGTGCATTCCAACGGAAGGGTTGCTTCCAAT
GTCGACGCGGGTCCCATACATGGATGAGATAGACTGGAGTATCACCTCGGACTCGATCATGCGTCGTATTAATGGCGAAGGTCAATCGCTCGTCATAATC
ATCCCAGTCTTGTTGGTTCACATCAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNCATTGTAGTACGTTGCTTTTGACTGGCAATACGGTTGAACGCGCGAAAGAAATACGACATGAACCCAGGGTCGCGATCATGCCGAATAGATT
CGCTCGCCCCAAATCGCCAGAAGACNNNNNNNNNNCCCTTCCGCAAATTTTTGGGCCGTTCTCGAAGAGCTAGCCTTAGCAATCACGTATCCAGAAAACA
TATCAACCCAAAGAGGCAATTCCGTTATTCCATTGAATTACCATGGCAGGGAGGAATTATAATCCATTGTAATAATATGAAAAGGATACGTAGCTTACAT
GCTTACCAGATATTCTCCACGTAGCACCGGACATGACTTCCCGGTTTTGCAGTCGACACACTTCNNNNNNNNNNNNNNTGCACGCTTGGGAAGAGACCTC
TCCAATGGAAGTGTTATCGCACGCGATGATACGTGCGGTCCACCCCTTGTTGACCCCCTTCCAGACTTGCATGATAATGGTGTAGAATATCATCTTGGAG
CAGCTCCAGTATCACCAAACGAACGAGCTCAACACGATCATCGGAATTTGTCGCAGATTGCGGGCAAAACTGCAACAATCCTTCTTCATCTACCACGTAG
TCTGGGGCAATTACGGCACTTGATTTTGCTTTTACAGCTCCCAGCTTGGTTATATCTCTGACTAAGTAAAGCTTGAGGTTAGCGATCCAACTTTCCTTGT
CTTACGTCTGTTTTATACGGTCGAGTCGCATCTGCTGTACTACTTATTTTTATATAATGGTAGGTCCTCACGTCTTCCCAAAGTCGACCGCGTAATTGCC
GCCAGCTTAATCACTTGATCATTGCACGCAGGCGTCAATATTTCGTCCAGTCGATTGATGTCGCTCAGATCGTGGCAATCCTGATCAGTTAGAATGACTA
TTCCCTTTCCATCTGTAAAGCGGTGCTAGCCAATCGATCCGCGCTTTGATTC