Description :
From Genome Similarity Track
Location :
Scaffold_2115:664- 3257
Sequence
2593 bases(100 bases per row)
CCTTCCTACTCTTCTTCATGAGACTGCATCACGCCGAATCTGTTACGATTCGTACGATCTCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTG
CCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCAATACACCAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGT
GATCTTCTCGACTTCGAACTTGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACC
GAAAGACTGATCTGCGGCCGATCCGGGTATTCTTTGACCAACTTCAGCTTGGATACATGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCA
GCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCGGAACGGTCCATGCCATGGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATA
AAGCCACACCTGCGATCCCACTTGGATTAGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATTGCACTCCGCAGTCGTTCGTTCACC
TGGGATCTAGCTTGCTGGTAGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTTTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTA
GGGTGGATTTGGGATCCCACCCATGTACCAAGTAAAATGGGGTGTCACCCCGGATCCTGTCTTGAGCGGTGCTCATCGCGAAGAGGAGTCGTTCTGCGTA
CTCATCCCAATCCCCCTGATCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGACCCATTAGCTTGGAGACGG
TATGCCATGGTTGCTCGCTGTCTCTGCCCCAGGATCCGGTTGAAAGCTCGAAAGAAATCAGACATAAAACCTGGCTCTCGGTCATGTCTAATCATCTCAC
TAGCCCCAAATCTTCGGAAAACGTACTCCTCGTACGATTCGGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCAGCACCCAG
ATCAACAATTCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATGTGATCCATGGCTATGCTTTGGTAAAGGGTAAGTCGCTTGGACATTCCCAGGT
GACTCCCCTTCGATTGTGGACCTGCCCTTGCCTGTCTCACAATCCACACATTCACCGACATATCGTTGCACGCTCTTGAATAGCCCCCTCCAATGGAAAC
ATTCCCGGATCCGTTGGTAGGTCCGACCAATACCTTGATGTCCACCTTCTAAACTAGCGTGATAGTGATGTAGGACATCCTGTTGTAAGGTTTCCGGCAC
CACCAGTCTCATCAATCCATCCTGATCCTCGCTAACTCTCTTCGTAGGGGGACAATAGAAGAGCAAGTCATTCAGATCCATTGCATAATCGGTAGCAATA
ATACTGTAGGATTTGGGTATTCTCCCCTACCCCAGTTCGGTTTCGTAAAATCTCCCCACAAAAACTTTCTCCGTCTCCAGAATCCCGGCTTCTTCTTTTG
TGGCTTGAGGATCCGCTCAATGCAGATCCCCTTCACAATGCTTCGTCGAGAATCTGGGAGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATTA
CCTGGACTGTCCTTTTTCCAGATCCAACCACCACCACCTCGTCTAGTCGGTTCAGCGTGACGAGATCCTGATGCTCGGCCTCTCTCTCCACCTCGACACC
ACATTGATTCCGTAAAGCGGCACTGGCCAAGCTATTTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGG
ACCATCACTTTCTGCCGTAATAGTGTTAGGGCCAGGGCCGTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAGTTTGAATCCCCCACAAATCCCC
AGCCTTTTCGGATCCTCTTCCTTTAGTAGATCCAAATCCAACAAGAGTCCGTTGTACTCCGCTTTATTGACGGTGAGGCTCCCCGCATAAGTGGATCTGG
TCCGTACAACTTCCCATCCGGGCAGTCTCCACAGTATTGCGTTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAGCTCAGGACGTACAG
ATCCTCATCCACTTGTACCGTCGGGATCGGGATCTGGATCCGGCGTTTGGTCTCTTTCTTAGGAGCGATCCTAGTCAGCGCTTCGTCCATCTTGGCGCTA
GGTGTGATGCTCGCGGCCAAAACGCCCAGGATCTCGTCTTCCCCTTTCGAACATTTAACGATCTCCAGTGTCCAAGGTGAGCGTAAGGCTGACCACTGTC
CCAATCGTCCTTGTAAGCCGGCCGACTTGAACAACCAAGCTAGCGTAGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTGAG
ATCCAACACGCGCAGGAGCGCGAGTATCTCTTTCTCCACCGCTCCGTAGATCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGG