Description :
From Genome Similarity Track
Location :
Scaffold_1413:664- 2310
Sequence
1646 bases(100 bases per row)
CTAGCTGACTTGTGGCTCGTACCTTCTGATCCACGGCAGTCCAAGGATGACATCAAATTTGTCATCCAAGTCTAATATGATGAAGTCATCATCGTATTGG
ACTTCCTTCAGTGTATAGATAATACCCACTACACGTTTCATCACTGTTACGGATGCGCCTGTCGCGAGGCGCACCGTCATCCTCGTTAGAGGGATCTCTC
GCTCAACATATTCGAGCTCTCTTTTGTCTAGCGATTGGCGTCGTACAAAGTTGTTCGACGCCCCACAATCGCACAATCGACTAGAGTTCGAAGCGACATG
CCTTGTGTCGCTTCGAGTTTCAAGGTAATGAGGGAAACATCATTACCAGAGGCAGAAACACACAATGACTGAGTGTTGGAAGCAGCTTTCGTCAATAGGC
CTGCAAACTCACTCGACATTGCTGAATCGGTAGGGTGCTCCGCACGTACTGACCCTGACCGTTTGTTTTTTGGCTGTCCGTTTCGTTATTGCGTCTTCGC
AACAACGTCGGACCCACGCCTTGGACCCCACTTGGCCGCTTGGTGGTTATTGTTTCCTGCGGTACGTGGTACCGCGCTCGGAGCACCGCATTCGTATGCA
TAATTCCCTATCTGTTGACATCTGTTGCATTTTTGCAGTTTCTTGAAGTTTTTAACACGAGAGCTCCGCTCCCCGCGTGACAGAAGTCCATTGGTGCGGG
GCCTCCATTTTCTTGTCGTCTTGACGGACGATAGGAATTCGAATTCACGTGAGCCTTTTTCACGCTGAAGTCTTCCTGTTCCGCACCCCTTTCGCCTCTT
CCAGGGTGTTGAACTCCAACCGGAACAGGTAGGTTTTAACAGGACCATCAGTCAAACCCTTTATGAACAACGTAATCAACGTGTGTTGATTCAGTGGGTC
GACTGTTATCCAACTGGTAAGGTGACGTATGTACTGAATGTACGAGTGTACGTCACATTTACCTTGCTTGATTCTCAGGAGTTTAGAGCGAGCCCTGAGC
TCAGCTCGCGGAGGCTCAAAAGTTTGCCTTAGCAGGGACTTGAAGACATCCAACGACCCAAAGACATATGGGTCGTGGAACTTAAGGCCCAAGGCCCACG
TCTTTGCCCGTCCTGGCCAGTTCGATTTAACAAATGGGATCTGGACTTCTTTCTCCACCAAATGACGAACCCTTATGGCATCCTCTAATTCCCCGAACCA
TCCTCAACAGAAAGTCTTCATCGGCTCCCCTTGTACTTTGGAAAGTCAATCTTTTATAAGTCTCTGGTCCGACGTGTATACGTCGACCCCGGTAGGCTGG
TCTGCTGCTGTCTCAACAGTTTAAACCTGATAAACAACTAATGTTCTCTCAACAGCTCTGTCTGTTGAGAAACTTGTTGGTGAAGCAAGGTTACCTTTCC
CGCTCGACGTCAAGTTCATTATGAATAAACTTGGCGATGGTGGCGTGCTGGCCGTCTGGCCCAGAGCGGACAGCAGTGCGCCAACGGCTTCTTGCCCTAT
CGTCGAACTCAGGCGTTCGACGGCATCCCATTTGATTTGACTCAAATGGGAGTAGCTTTCATGCGTAGGATGAAAATCATCCCCCTTATTGTCCAACATG
TTCATGGTCGTTGAACGGACTACGAAGTGCTACCAGGTGTAACGGG