Description :
From Genome Similarity Track
Location :
Scaffold_636:664- 2175
Transcript NameFunction/comments
Phypl_g9964Amino Acid/Auxin Permease (AAAP) Family

Sequence
1511 bases(100 bases per row)
cggccttcttcacgctcgAGGATGCCAAGACCATTTTCAACAtcgtgtgctgcttcttcggcaTCGGAACGCTGTCCATGCCGTCCAACTTCGCGCGTGT
CGGGCCCGTGTACGGCACGCTCGCCATGCTCTTCATGGCGTTGGCCAACATCTACGCGACCGTGGCGCTCTCGCGCGTCATCCTCGTGGCGCCGCCCTCG
GTCAAGACGTTCAGCGACGTGGGCGACTGGGTGCTCGGCAGGACCGGACGCTACCTCGTCAACGTGTCCCAGCTGCTcgtgtgtctgctgctgccctgCG
CCTTCCTGGTGCTcggcagcacgctgctggacgtgctgttcCCGGACTCGTTCAGCCAGATCTTCTGGATCGTCTTCGTGGCCGTCACGGCCGTCCCGGC
GTGCTTGATCCCGACCCTCAAGGCCGCGGCGACCGTGGCGTTCATCGGGTGCATGGGCACCGTCATCGCCGACGTGGTCGGTGTCAGCATCCTCGAGTGG
GAGATGCGAGGCCACCCGGTCGTGCCGGCGCCGGACCCCTCGCTGCACCAGGTGCTGACTGCGTTCGGCAACCTGTCGCTCGCGTacggcgtcgccgtgc
tCATCCCGGActtgcagcggcagcactcgcagcCCAAGCGGATGCCGCGCGTCATCGTGGTGAGTCTGGGCATCGGCTCGGCGTTCTTCCTGGCGGTGGC
GATCGCCGGCTACGTGGCCGGCGGCTGCCAGCTTTCGGCcaacctgctcttctccatcgtcaACATCTCGGACCCGTCGTCCccgtcggcgctgggcttc
gTGCCGAACCACGGCGCGGTCATCATGGCGTATCTGTTCATGCACCTGCACGTGGTCATTGTCCTGTCCACGGTGCTACAGCCGCCGTTCTACATGGCCG
AGCGCCTCATCCTGGGCATGCACAAGGACCCCGTCGAGGCCGTCTCGGCCCAGCAGGACAAGCCCGAGGAGAACGACGGCtgggaggagctgcgcgatAA
GCTGTCGACGAACGGCCACCCCGTGACCAGCGTCAACGAGCGCGCGGCGAGGGACCTAGAGAGCAACGCCGGCTCGGACACCGAGACTCTGTCCAACTcg
gccaagcgcgagctggaggagaaggagcacgaCGAGTCCCAGCTCTCGGACTACAGCGGCTCGGCCAACGTGTGCCGCTACGTGACGCTGCGTCTCGTGA
TCATGGCGATCCTGGTCGCGGCCGCCATCGGCTTCCGCTCGCACTTCCTGGACCTCGTGGACTTCACGGGCGCATCGGCCATCACCGTGTGCTGCctcgt
gctgccgctcgtgtTCTACCTCAAGGTCTTCTGGCGCGATCTGCCCATGTACGAGCGTGTGGTGGCGGTCGTGGTGATCGTGGTGTGCACAGTCGTGGGC
TGCTACGTGATGATCTACGCCGGCAAGAACCTGTTCAACCCGGACTcggacagcgccacgttCCCGTACTGCTCGGAGGAGTTCCAGTCGGACCCGTACT
ACGTGCGCAAC