Description :
From Genome Similarity Track
Location :
Scaffold_569:664- 2101
Transcript NameFunction/comments
Phyra_86258telomerase reverse transcriptase

Sequence
1437 bases(100 bases per row)
GGGTCAAAGTACAGCGCATGCCAGCGCTGACGAATCGCAGAAACCACCTTGGTAACGAAAAACTCTTGTGCCGCTTTCGTTTCGTTGAAAGGGATCGAAG
CTTGCAGCAACGAGCTACTCAATCTACAGATCATAGAGTAAGTTAGCTATTCCATTGGTGTACACCCCAACATGACAGCACTTACTTTTCATAGTTGACG
TAGAGCTGAAGATTGGTAGCATCGATCAGCATACCGCACCATGAGATGCACTCAGAACCTGGTGCATTGGTTGGAAGCCCCTGAGTAGCTGCAAAATTCG
CTTGGCTCTTGGCAACATTGACAAAACACCCAAATTCCTCGTTGCCCTCGTGCATCACGGCGACGAACCTTCGCGCCCTCTTCAGGTCCGTCGTAATGAA
CATGAAGTCATCGGTGTACCGAAACAGCCCTTCGTGTTGACAGCAAGATACTGGTACGATGGCTGGGTCGCATACCTCAGGCAATCGTTTGCCGAGTACT
CGCCGCTCGAAATGGGCATAGTACATGTTGCACAACGTGGTGGAGAGCACGGAGCCCTGCGGGATGCCGCATCGCTGAACGTAGTCACGGCCATCGACTT
GGACGACGTTCGTAGACAAATGCTCCTTCAGCAGCTCGAGCGCTTTAGCTTTGGTCAGGTAGTCGTACAGGACACCGTCCACAAACATTGCGTTCTCTTT
CTTGGACTGCGCTGCAAGTTCTTCAAACCCCAACAATTCTCCAGACGGATATGCCGGACGCTCCAACTTGAAGAAAAACGAAGACGAAGGCAGCGATTCA
TCGCTATCTGAGATCGGAGCGACTTGGTGGCCAACCCAATGCTTGCGAATGAGATATTCATCCTCTTGTATCGCCTTCTTGAGAACCTGATACAGTTTCC
GAGGCCGTATGGTATCAAAACAACGCTCCACATCGACAGTCACGCAGTAAGCCTTTGGGGTGTCCTCTGATGCACTTCGACGCTCTTCGCATCGAGAGCA
CGAGGAGATTTCACGGAATAGAGGCTTGATGCGCTTGTAGATTTCATCCACGTTTCGGACGGAGGCCCCAACAAATCGCTTTGGCTGGCGCTCCATCTCG
AACGTCAACACTCGGTGTATGGTTTCCATGGATCTGTTCACTGAGACTTTGCCTTGGTCCACAGCCCTAGATAAATTCATCAGCGGTCGAATTCCACTCG
GTTTCGGGAGCAAGCGCAAACGAGAGGTTGCTAGCTGCCGTCTACGGTTGGCTTGCAGGGTTTTGTGGCTTGATGGTTGAAGAATGCCTCCCTGTAGATC
GTCTAGAGCAAGTGTGCTGCAACATAACAATTCAGCGCTTAGCACTTGGCAAGTCGCACCCACAGTAGCTAGCTACCCCACCTGATCACATTCCAGACTG
GACGCTGATAGAACTCGATCTCATTCGCCACTCCTTC