Description :
From Genome Similarity Track
Location :
contig_28:6639- 10966
Transcript NameFunction/comments
g6867.t1hypothetical protein
g6868.t1XP_008899719.1 hypothetical protein PPTG_07304 [Phytophthora parasitica INRA-310
g6869.t1hypothetical protein

Sequence
4327 bases(100 bases per row)
CTCCCGGTCTCAACCTCGCTCTAAATTCCGAGGTTGAAGTTCGCTCTGTAACTCTTACTGAATAAATGCTGAATTTTTGTCCCCACGACTGGAAGTACGA
AGAAATCACAAATTCTGTTTTTAAATTTTCAAAATAACCACATTGAAGCGGCATTGCACCATCTTGGTCGGAAATTCCTCTCGTTCAAAATTAGCGAAGA
AAAACAAGCTTTTTAGAAATGTCAACATTTGTATCTCAAGCAACTACATCTGCTTCGGTAGCAATGCGACTTCTATCGACCAAATCTAGGCTCTCTACTT
ACAAGTTTTCTATGAGAAACCCGTCAACGCCAGAGCCATACGCCGTGTTGATGCTGTAGCCAGCGATAAGCACTACTGCTGCTATAACCGAGACCAAGTT
GCCGATGAGTCCGCAAATGGTGGCGGCACCGATCAACACGAGCCAGAACATAACCAGCACGGCCATCGCAGGCACTTGATCCTGCTGAAAAAGCGGTTTT
GCTCCGTCCGGAAGCTTACCATTCGACTCGTAAAACGCCTTCAGCAAAGACTCCTTGCGTTCAAAGCGCTTCTCCACCCACGTCGCAAGCTCGCTCTCGC
TTTTGTCGCGCAGCGACGAAATGTCCACACGCTCGAGGTAGAAGTGGATCATTCGCGGCACACGACCAGTTAGCAGCGACGTCTCCGATGGACGTTCGTT
TGCGGCGTAGTCCACGTAGAACATGGTAACATCGTATACAGCGGTGAGTTGAGAGCGCAGTAGCGGAAACATAAATGTCCAGCCTGTCGTACGCGGGTAC
AGCGAGTACTGACGTGGCGGCAGTCCGTTCTTCTCGGCGAATACAGCACTCTTATCAAGGTTACTCTCGCTCAGATCCGTACCTTCTGGGAAGAGGAGGT
ATGAAGCCTCCGGTTCTGCCGACGTGAGGAACGGCAGCAACTTGCGCAGGTTCACTTGGTCATCAGCCCAGCGGCGTTGCTGTAGAGAGCAGACCCCACG
TTAGCGCCTCACTCTCATTGCTTCCTAAAGTGTAGATGTTACCAGAAATATGAAGATGAAGTGCTGCATGGCCCAGCCGAAGATGGGGATTTTGCGCAGA
GGGGCCTTGAGGACGATACGCAACTGGTGCAGCGTACGCGTTCGCCAGGCCACACTCCACAGCAGCATCCAGTCGATGCGAGTGCGGTGGTTCGACAACC
ACAGTGCGCGGTCTTGCGGCATGTCGCTCTCGTGAGCTTTGGTCTCGGCGTCGCCGTAGACCTGCACCTGGATGCCAAACAGTTTCTCTGGCAGAAGTCA
TAGTGAGCGTCTCGCACTGCCAACGGCTTCTATAATACTTGGAAGTGGCAGATCCACGCACCCAGAAGCAGCACGACTTGACCCATCCACGCCCATTGTC
TGCTCCAATAAACACAACAACAGCTCATTGAGTAACAAACCTCCCGTCATCCTTTGTTGGGATTCCACCGACGCACATGCAGCGAGTGACGCGGCGGTAG
AAGCGTTTGGTCTGCAGAAACGCCGGCAGAGGCAGGGCCGCGAGCACGAAGCACGGGGTCAGCACCCACGCTAGGGCTGTCCAGCCCGTGAGCGCCAGCG
ATACCAGGAACACGACACCCACAACGGACACTCGCATGGTCTCCGTTGCTAATTCTCAATTGATACCATAAGCATCTGATCGTAAGTTATAGGCTTATCT
CCTAAGATATGTGATACATATATTTATACAGCCTTAGGAGATATGTTACACTGTATATCCACTCGCCTTCTTCAAGATTCATTTTAGCTTTGGAGAGGCA
GAAAATGACGACGAGGGAGGAAGCGGAGCGCGACGTGAAGCTCCTCGTGAGCTTCGTGGCCATGGTCTTCGTGGGACTCGGCAACAAGAGTGCGTGCTAG
TCTCTAATCTGCACAATAAGGTTCTTGTACGGCTTAAAATCTCCCAACTGACGCACTGTTCTCCGTCCTGGATGAATCATTCTCTGCTCAGTCTTCCAGA
AGTGAGTTTTGCTACACTTGGGGTGCAGCTTTACTTGTGATTCGTATACTTAACCGATGACTTTGATAGACTGCAGACCATCCCGATGCACAACTACCCG
ACGTTCCTCAACCTGCTCACCACGTTCGTCTACGTACGTGCGGCCTTCGAGTGCATGCTGTACGCTTTACTAACTGGGTGTTGGATACACTGCAGATCCC
CATCAGCTTCGCGTACATCCTACCGATGATAAAGTATGGTAGTGCCATCACGTGGGACCAACGCAGCATCCCGAAGCGGAAATTCGCCGTTATGGGAGGA
CTCGACTCAGTCGCCGGCATCCTGCAAGTGTTTGCAGCCACCTATCTGGGTGGATCGCTCATCATCTTGCTTGGACAGGCTGCGATCCCCATTTCGATGT
TGATCTCCAGTCTGTTGCTGAAAGCCAAGTACTCGGGCTACCAGTATGTTGGAGCTATGGTCGTGACGCTGGGCTTGCTGATTGTACTGGGGTCGGGCGA
CTCTGGCAGCAGCAGCGGCACCAACCCGCACCTCATTGTGCTGTGGTCTGTTGTCATGATTTTCAGCTGTGTCCCCATGTGCCTGTCCAGTGTATATAAG
GAGAAGACTCTGGGGGAGGCAGAGCTTGATGCGGTCTATCTGAATGGCTGGATCGCAGTGTTCCAGTTTCTGTGTGCTATTCCACTGACGTTCCCGGCAG
CAATGGTTGGCGACCACCCAGTCACGCCGAGTGAACTCCCGGAGAATATGTATGACGGCTTGATGTGCTACTTGGGGCAGAACACCATCACTGAAGGCGC
GCACAAGGATGACTGCGAGAAAGCGACCATCTACGTGACGGCCTATTTGCTGTTCAACGTGGCGTACAACCTGCTCATCATCTTGATCCTCAAATTCGGC
AGCGCCAACATCCTTTGGCTGGTAAGATCCTGTTGACATTTGGCCATTTGATCACATGAAGTAGCTTTCTCTGACCGTTCTTGTGTTGAACAGGCCATGA
CCATTATGGTTCCACTGGGCAACGTCGCGTTTACGTTTCCGTTTATGCCGGAGCACCAGCCTCTGCACACAAAGGACATTGCAGGCTTGCTGTTCATCAT
GCTGGGGCTGTTCGTGTACCGCTTCCTGGAGGAACTTATGGACTCTTGGAACAAGCGGAAACCCGTGTACCCGGACGAGAAGGGCCCGGCCGTAGACGAA
CTCAAGCGGGCGCTCATCAGCAGCGACAGCGACAACAGCGATGATCAAGAAGTCTAAGTAAACGGCATACAGTTACGGGTGCACTTTGCAGTGCCCGCCA
TTGTTAACGAATGAAAATCTATGAGACGTGTTACGTGTGCTAGTACTCGAAGCCCACTGCATCGTGCTGGTACAACTTACTTGACTTCAACCCGTCAAAG
TGCTGTACGCACACATATAGGGGTTAGGTGTTATGTACACCACACGCTCCACGGATGGCTATCGCTTATCGACCGCAGAACCGGGAAGACCACCACTGCA
CATCGCTGAGCATGCTGGCCGCCGCCACCAAGAGCTTCGTGCGCGCCGCGGGCGCCGCCGGGTCGCGCCGCGTGCCTCTTTTCAGTGCGCAGGTGTCTCT
CTTCTCCGCAGAAGCTTCGCCCGCCGCGCCCGAGCAGCCCAAGCGCGCCAAGCTCAAGATCCCGACCAAGCGCGCGGCGTCGCTGCTGCTGCAGCTGGAG
GCGGAGGCCGTGGCCAAGGCCGCCGAGGGAAAGGACATTGACAACTTCAAGCCCGGCGATTCGGTGGAGGTGCAGTACCTGCTGAGTCGCACGGGCGCCC
GAGTGCAGCGGGTCAAGGGCGTGGTGCTGGCGCGGCGAAACCGCGGCACGGGCAGCTCGTTCGTCATCCGCAACGTGAGTTTCGATGCGTTTACGCTGCA
GCGGTGAGAGGCTAATTATCATTTTATTGTTTGTGACAGCACATTGGCGGCTACGGCTACGAGCAGAAGATCTTCCTGCATTCGCCGCTGCTGCAGAGCG
TCAAGGTGCTGCAGGAGGCGTTCATCCACAAGGGCAAGAAGCGCGTGCGTCGTGCAAAGCTCTTCTATCTGCGTGAGAAGGCGCCCAGCTTCACCACCGT
CTAGGCGGTGCGGCTACGACAGACTCGGCGGAACCAGCAACGAAGTCGTCACAGCTACCAGTCGTGCAGATGTCTGGATGGAGGTAGCAGCGCTGCTGGT
TAGATGTAAGCGGCACGGGTAGGGGGGTGGTAGCAGCACTTAACACTAGAGAAGAAAAACGATTCACAGACCACAAGCTACAGACAGGAACAGGGTCGTC
TGTTATCGGCAAAGGGCAGCTCGTTTA