Description :
From Genome Similarity Track
Location :
Scaffold_649:6639- 8038
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_649-snap-gene-0.7Amino Acid/Auxin Permease (AAAP) Family

Sequence
1399 bases(100 bases per row)
GCAAGCCGTTCTTCACGATGGAGGACGCCAAGATCGCCTTTAACCTCTTCTGTTGCGTGTACGGTATCGGTACGCTCGGCATGCCGGGCAACTTCTCGCG
ATCCGGGCCGGTCATCGCCGTCATCGCGCTGCTTTTCATGGCGTTCGCCAACGTGTACTCGTCCGTGGCGTGCTCCAAGGTGATGCTCGTAGCGCCAAAG
TCCGTCAAGACCTACGGCGACCTCGGCGAGTGGTGCATGGGCACGACCGGCCGCTGGCTGGTGCTCGTCTTCCAGATCAGTAACTGTCTGCTCACGCCAT
GCGCGTTCCTCGTGCTCGGCGGCACGCTGCTCGACAGCCTCTTCCCAGGCGCGTTCAGCGACAAGACCTGGATCATCCTCATGGCGATCCTCGTGCTCCC
AGTGTGCTTGATCCCGACCATGAAGGAAGGCGCCGGTGCTGCGTTCGCCGGCTGCATGGGAACGCTCATCGCGGATGTCATCGGCATTGCGGTGTTGCTC
CACGGCATGGACGGCCACCCGTCGGTCCCAAAGCCAGACCTGTCGTTCAAGCAGGTAGCCAACACGTTCGGTAACCTGTCGCTCGCCTACGGTGCCGGCA
TCGTCATCCCAGCGCTCCAACGCCAGCACAGCGACCCGACGCGCATGCNNNNNNNNNNGATCGCGATCACCATGACCACGATCTCCGTGCTCTTCCTGGT
CCTGGCCAGCTCCGGTTACTCGGCGGTCGGCTGCCAGATCTCGGGCAACCTGTTGTACTCGATCTTCCCAGACTCGGTGACCGGTCTCTCCAAGCTCGGC
TTCCGCTCGGACAAGGGCATGGCCGTGCTCGCATACCTGTTCATGCAGCTGCACATCACGATCGCGTTCTCGGTCATCCTCCACCCAGCGCTCTACCTGC
TCGAGCGCATGGTGCTCGGCATGCATCAGCGCAAGCCAGAGGACGTGGAGGCGGACGCCCACTTCGAGAAGGTCGAGACCCCGGGCCAGCACGACGAGCT
CCTCACGCGCGTGTCCAAGGGCTCGGTCGTGTCCATGGCCNNNNNNNNNNCGACGAGGAGGAGGAGCTGCTCGAGTACCGCGGCGCGAACGTGCTCAAGT
ACATCGTGCTGCGCATTTGCGTGATCATCGCGCTCGTCATCGCCTCGGTGCTGCTCAAGGACCACTTCCTGGACCTGACCGATTTCATCGGCGCGTCGGC
CGTGACCATGAACTCGATCATCCTGCCGATCATGTTCTACATGAAGGTGCTCTGGCCAAAGATCCCAATGTACGAGAAGATCCCGGCGCTCGTCGTCGTG
ATCGTCTGCTTCGCGCTCGGCTGCTACGTGACGTACACCTCAGGCAAGCAGCTCTTCAACCCGGACTCGACCGACCCGGAGATCCTGTTCCCGTTCTGC