Description :
From Genome Similarity Track
Location :
Scaffold_60:663864- 665658
Sequence
1794 bases(100 bases per row)
CTACCTATAAATATACTCAGCTTACAGCCTACCTTAAATTGTTTTTTTGTCACCTCGCTCCCTTTAAGTAAAAAGGGACCTGTGAACTGCCGTTCACTGA
GAGTTTGTAAGCGCTCGGAAGCCAACTTCCTCTAGTGCAAGGTGCTGTGTGACCCCGTTATCCTTGATAGCACTCGTAATCAATCCACGCCAAAGCGGGT
CGACTACCTGAACCTCTCTAAGATTTGTTGCCTTGGATATGAACAACATTTCCCATCCGAACGGCTCACAGTTCGAGTTGGTTCAAAAGATGGCACGCAT
CTTCGAGATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCCGCGCAGCTCGAGCGCGTCAATGTGTTTGACACTTACGAGCAGGGGCTCATCGCG
CATGTGCGGGAGAACCTGCAGGCTCCGGCGGTGGAAGCGAATCCATCTCACCCGAAGCCAATTCGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCG
AGAGCCTTCACTTCTGGGTTCGAGAAGTAGAGCTCGCTATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCCTTTGCACTCTCCAACCTTAG
CGGCCGTGCTAAGGGTTGGGTGTACACACGGGAGGCAACATCCCCTGGATGTTTTACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTC
CCGGCGAACTACGAGTTATGCCAACGCTCGCGCTTCCTCTCGTGCAAGCAAGGGAGGCGTGAGCTGCACGAGTACTTGCAAGAGATACGGGAACTCACGG
CGTCCCTAGTGGGAAACCCACTCAGCAAACACATCAAGATGACAGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCGCGCACTCAGCTGTTCCGGGTGCA
GTCAAACACCCTTGAAGAGGCGATTCAAGTGGCTCTTCGGGAAGAGTATAGCCATCGCCAGGCGCGTACGCCGGCCTCGCATGGCCTGGGAGTTCCTTGT
CGACTCCCGGTCGAACGAGCCTCCTTGTCGACTCCCGGTCGAACGAGCCCCAACGGACCAGTTCCCATTGGAACTCGGCTCCGCCGAACAGCGTGACATC
CGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGATCTTTCCCCAAGCCCGTCCTCAATGGTCGCT
GGCAGAAGCCAGGATCCAGGATCCAGGGGACAGGGGAACGCCGGAAACCAATAGGTGCGGGGCGCCCTACAGGGGAGGAACTAAGTCTTCGTGAAGGGTG
CGCGGGTGGCGCGTACCACGGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGTGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGT
ACGGGGATACGATCATCCCTTCAGAATCTAGATCGATTCTGGGGCATCGAGGAATTTCGCACGCCGCCAGACAGTTGCTCGTAATAGCAACAAGTTGTCC
GATGTTTTGAGAGAAAGCAAGGGCAACGGGACAGTATCAGAGCGACCGGCTGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGATGTCA
AGCTTGAAGAATTTGACAGCCTCGAAGAGTTCACTGTTCTCGACATGGATCCATACGATATGATCCTGGGCATGCCCTGGCTGAGAAGCACGAGCCCTGG
ATCGGCTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGCCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGAACCCAGG