Description :
From Genome Similarity Track
Location :
Scaffold_25:66380- 72329
Transcript NameFunction/comments
Phypl_g1053hypothetical protein PHYSODRAFT_313196
Phypl_g1054hypothetical protein PHYSODRAFT_465114
Phypl_g1055hypothetical protein PHYSODRAFT_313194
Phypl_g1056hypothetical protein

Sequence
5949 bases(100 bases per row)
gacgccgacttcAAGGCCAAGTACAACCTGGGCGCCGTCAACTCCATCAACTTTGCGCGCATCCTGGCGCAGGTCGTCTACTACGTCTGGGCCTACTTCC
GTGCGCGCGAGCAGGGCGTGAGCGGCGAGGTGGCCTTCTCGGTCCCCACGGGCAACTTCGGCGACATCCTTGCCGGCTTctacgcgaagaagctcggcGT
GCCCATTGGCAAGCTGATCGTGGCCACCAACGAGAACGACATCCTGgaccgcttcttctccacgggcAAGTACCACCGCCGCAACATCCAGCACACGATC
TCGCCGTCCATGGACATCTGCGTGTCCAGCAACTTCGAGCGGTACCTCTTCGCTCTGTCCGGTGAGAACCACGACATTTTGCGCGGCTGGATGCAGGGCT
TTGAGCAGACCGGCGAGCTAACGATCtcgggcgagctgctcaccAAGGCCCAggacgagatggcgtcgtACGCTGTGCTCCAGGAGGAGGTGCGCTCCAC
CATTGCCGAGTACAAGAAGGTGCACCAGTACCTCTTCGACCCGCACAGCGCTATtggcgcggcggctgccaTGCATTTCGGCCAGGACAAGCTGGCTGAC
AAGCCCAACTCGGCGGTGGTTGTCGTTGGCACTGCCCACTACGGCAAGTTCCTGCCCGTGGTGTCCAAGGCGCTTGGcgtggcggaggcggagatccagc
agcacccgattctcaaggcgctggagtcgCTCCCCACCCGGCTATCGGTCGCCAACAACTCGAGCGCTACCGTCGCCGAGCACATTCGTAAGACTGTcgc
gaagaagaaccagAAGACCTGCAGTCTGTGGACGTCGGCTCCGACCGAGTGCAAGCTCGCCGCCTTGGCGCTTGCCGCTGCGACCGTCGCTGTTGCGTTC
TTCGTTGCTCGGCGTTCGAAGTAAACAGCTACGCGATGATGGCggtgcggcagcagcagcagtgcgtTAGTCTAGCGGACCTTAATCTATCGTGTTCATT
ATCTGATGGGACGTAGTACATAGAGAAAAAAGCAACAACGGGGAAAACAATGTCCATTTTGACTCGTGAAGAATAAATTATCGCACGAATGAATaagcag
aagctggacaTGCGCACGTGACGGACGGCTAAATCAACTTTCTTACCGACAAAGAGATCACTGCAACCATGCGGCAGCAGAGTCTTATATCCTACTAGTA
GTTACTGAAAAATGCACGACCAACGCGTGAGCCTTTGCTTCTATTCGACCCTGTACCCTTCATCCTGTACTTTTCATTCTTGCGACTGTTCCTCATACTC
GTTGAGTTGGCTTCATCTTGTCCTGGGTCAGCACGCAGACCTGTAATTGACTTGTGTTGGTTGGTTGGTTCGGTGGCGAACAAGAGGACGGGTTGCCCGT
AGCCCGATGACCACGAGGCAAGCCGTTCAGCATCGGACCGATGCCTACAATATTGTGCAGTCGCTTGCACAGACACCACATTGCGGCGTCTGATTCTGTG
CGAGATACGCCTTCTGGTGCTGTCTCTGGAGGCTCTCACGTGTGACGGTAACGACACTCGGCGATCCGCTCTTCGACCCATTAGCAGGCGCTCGGAAGCT
CTGCTGAGAGGGCTTCGCTGGTTCTTTCGGCGCAAACGAGATCCGCTCCTTGGTGTACTGGTTCTCGTACGAGTATTCGCCCGGTCTGGTTCTGGATAGA
ACGCGCCGCCACCCAGGAGGTAATCGCGCGATCTTCTTTGGCTCAGTCGGCGACAGCAGACGCCCCACCGGCACaatgagcttcttgaaggcgtccacga
cgttggtcgagtccagcgccgaTGTCTCGAGGAACTCCATCGAGTGCTTCGCTGCGAACCTCGCGGCTTCAAGCGTGGACACCTCTCTGCTCTCCGGCAA
GTGAGCGAGGTCGCACTTGTTCCCCACGAGGATGAGCACGAGGCTCTCGTGCGAGTGCTCGTGCACCTGCGCTAGCCACCCGGTGACGTGCTCGAACGAG
CTGCGGTTCGTGATGTCGTAGACGATCATGGCGCCCACCGCGTTGCGGTAGTAGGCCGCCGTCAGCGACTGGAATCGCTCCTGGCCCGCAGTGTCCCAGA
TCTGCGCCTTGAGGCGCCGGTCCCCGACGCGAATGGTTTTGGTGGCGAACTCGAAGCCCACGGTCTGCACGTTGTGCGGCATGTACTTGTTCTTGGTGAA
GCGCATGACGAGGTTGGACTTGCCCACGCCCGAGTCGCCGATGAGCACCACCTTGAGGATGGACTCGGCCATGGGCGAAGAGGCCGGCGACGAGCCGCGC
GGGCTGTTGGAGGCCGAGACGGACGACCCGGCGGCCGAGATCTTGCTGGAGCCGTTGGCCGCGGGGCTGGACGCGCTCTCGCTGAActgcgtggagctgg
tggagcgccGCATGTCGTGCTGGCGGAAgacctggtgctgcgccacctccttggccgagatgtactgctgcagcgggttgccgtcggccgccgccgcatt
gctgctgctgttgttgtcggtggcgggcgaggaggacgacgacgtggtcgcaggcagctcgcgcttgctgcccGTTGTCATGGCGATCGCAGCGAGGGCG
GGGACGGGGAGCGACTAAGATCGgatgtggcgctgctgctgctgctgcgttggccagcggaggcgaaggcgacgccTCGGCAGAGAGAGAGCCgcttgaa
gcgcgagaagcttGGGACCGAAGGAGAGTCGGTTATGCGTCGAGGCTTCGACGAAGCTTCCAGGGCGGAACAAAGGGCGTATTAGGCAGGAATTGCCTCG
GGCGGGACGGCAATAGAGAGAGTGGTTGGGTAGACATACAAATGTATCGATCGGTTTTAATATTGAATACTGTATAGATTATGTACGATCGCAGGTTATC
AGAGTTGGACAGATGTGGACGAATGCGGACGCATCGCAGATTTGTTGTCCGACATGGCTGCGCATGGAGCACCACGAGGGTGATGGTCTCGGcagagagg
gggggggggggggggggggggNGGGGGGGCGTGGCTTCGGACGAGTCCAAGCAGCTATTCCCAATATTCGCCGAGTGCAACTGCTCAGCGATggtcgcca
aggccaagaggaaggcagcggcgccggcggACAGCTCTCCCACTGCCAAGAGGATCACCCGCTCTAGTGGTGGtagacgagctgctgcagtcgagtccag
cgcctcTGAGGACACTCAACCgccagcgtgtgcagcgGATGAagcttcgacgtcgtcggccagcaggaagatCGTGGCGTTCCTCCGCGGTGTGAACGTC
GGGGGACGCGTGCACAGCATGAAATCcatcgccgacgcgctgggcgaggcCGGGTTCAGCAACGTCAAGACGTTCCTGGCCAGCGGGAACGTCGTCTTCG
ATGCGCCTGGCGAAGCGGACAAATCTACGGTGCTCACAGTCGAACAACGAGTCGAGGCcgcgctcgaggagctcttcggTTGCCACATTCCAGTGTTTGC
CCGAtccatggaggaggtggctGCGCTAGGCGATCGAGTCACAAAGTCCGCTATGGCCGTGAATgtggtgctggtgaaggaggaacTGACCAAGGAGCAG
CGAGATATCGTCGAGGCGCTCTCCTCTGACGCGGACGAGCTCAAACTGCTGGACAGAGCGTTTGTGTGGTACTCAGCCACCAAGATGAGCGAGTCCCCGC
TGTTCAAGGTGGCCTTCGACAAGAAACTGGGCCTACCCGTCACGGTTCGAACGGTGAACACCTTGCGCCGAATTGTCAAGAAATTTGGCTAGCTACGATT
GTTTTTTTGTGGCAGGATCATGATCGGGGGNggggggggggggggggggggggtaaaCGACGCTTGCAAGGTGATGTCAAAATGCCACAAGACGATCATC
TATTGATTTCATCGGGAGACCCGTGCTCCTTTCAGTACTTGCCCAGCCACAGTAACTTCACCCAGCTCTCATAGGACCTATCTTCCATGTCATATCGAAT
AGTGGTCTCTCTCTGCTTCAccacagcttcttcctctgtgcTCGAGATGGCGTCCCCTACTTCGAACTCGTGCTTGTACCGTGCACTTGTATCCTCAATC
TCTTGAGCTGGTAATTTTTCAGCTACTGCTcggtccaccacgtcctcatcgccatcgccttcgtcgttgtACGCTTCGACTGAAACCTCAGCAGGTAGCT
TTTCAGCGAGTACACAGTTCGTGATCTCCGCTCCTTTCTCGCTGTCATCGCTTTCCTCTGCAGCAGTAGCGTAGGTGTAAATCTCCCGAGGTACTGGACT
TGGCAATTCGCTGATCTCCATCTTGAAaactcgagcgagaaggTCGACGCCTTGTACCTCGTTTCTCGGGAGTAGCGTCACGGCCAATCCCTTCCCGCCA
AAGCGTCCGGTTCTCCCAACACGGTGCAAATACGTTGCTGGGTCCCGCGGCAAATCCAAGTTTACCTACGATTTCACAGAACGACGTTCAGAGATCAAGT
TGTCTAAACGACTGTACGTCACTTTCTTCAGAACGTACCACAAAGTTGACTTTATCAACATCAATGCCTCGCGCAGTGAGGTCGGTAGACACTAATACAC
GAGAGCGTGAAGCTCGAAAGCCTTCCATTACTTCCAAACGAGTAGCTTGAGTCTGTGAGCCAGTGATGCATGCCGCTGGCCAACCctgcgctgcgagagc
tgtGGCCAACGCCTCGGCGCGAAATTTGTCGTTGCAGAACACAATGCACTGCACAAACACGATTTCCGACAGCAGTGCTGccagcttcaccaccttTGCT
TTCATATTCAACACAtcgtcgcctgctgctgacccGAGTGGTGGTGACCCGACGACGCAATAAAACTGCTGCACATGGCGAAGCCAAAGCACCGGCGAAT
TTGACTGCTCTCGCTTCTTCCAGTTTTCGAGGTCTTCAGCGGACGAAATGAACTCGGTGGTGACATCATCCGGGCCTCGAACTCGCACGATCTGTAACAG
CAGTAGACAATTTAGTTCAATATTTCACATACAATTGCGTAGCACGAAGTCCACAAACCTGTGGAGTCCTCATTagctgcaccaccgcgaTTAACTGATC
AGGCGTGAACGTGGCCGAAAATGCGAGTGTCTGACCCAACAGAAAAAAAGAAGACACAAGTGAATGAGTTTGCTGACAAGGATTGCTATCTGTCGATCAA
GAGTATCGTCATTACCTGCCGTCTTTCAGGGAGTGCGTCCGCGATGTACTGGATCTATTTCACATGTAGAAGAGGAGAGGTGTCAATTCCCAAACCACCC
AAGGCTTCGATTCACCTCAATGCATCCTTACATCTTTCTCGAAGTCTCGCGCCATGAGTTTATCcacttcatccagcaccaacagtCGAATGGCACTGCA
CGGCAGTGAGCACTGATCCACGAGTGCCTTCACGCGTCCTGGCGTACCCACCACAATATGGCACCCCGCTGCCAAGTACATCTACTCAAACATGGCACCC
CCACCCCCAATCAGTTCCAGCGCCAAGCACAATGTACAAACAAACTTCCGTTACCTGGTCTTGCGCTACTGGCAGCCCACCGATGCACGTGCGGATGACA
ATGTCCGGTCGGAACTGCGCTAATTGGCGCAGCACGGTCTCAATCTGGACCGCGATCTCTCGGGTAGGCGCCAGGATCAGCGCCAGCGGGTCACCCACCG
CCATCTTTTCCGCCATCTGGCCCCGTTGCTCCACGTTGCGGATTGCGTGCTCGATCGCTGTGACCCCAAAGACCGccgtcttgcccgtgccggACTTGGC
CTGGCCAATGACATCGTTGCCGAACAGAGCCACgggcagcgcgtgcagctgaATGGGCGACGGACGCAGGAAGCGCATGGCTGTGAGTGCGCGCCCAACG
TCGCCATGCAGCGGGAGGTCGCTGAACGTTGTCGTGctggcagccagcg