Description :
From Genome Similarity Track
Location :
contig_28:6638- 10966
Transcript NameFunction/comments
g6560.t1RAW30662.1 hypothetical protein PC110_g12982 [Phytophthora cactorum
g6561.t1XP_008899719.1 hypothetical protein PPTG_07304 [Phytophthora parasitica INRA-310
g6562.t1hypothetical protein

Sequence
4328 bases(100 bases per row)
ACTCCCGGTCTCAACCTCGCTCTAAATTCCGAGGTTGAAGTTCGCTCTGTAACTCTTACTGAATAAATGCTGAATTTTTGTCCCCACGACTGGAAGTACG
AAGAAATCACAAATTCTGTTTTTAAATTTTCAAAATAACCACATTGAAGCGGCATTGCACCATCTTGGTCGGAAATTCCTCTCGTTCAAAATTAGCGGAG
AAAAACAAGCTTTTTAGAAATGTCAACATTTGTATCTCAAGCAACTACATCTGCTTCGGTAGCAATGCGACTTCTATCGACCAAATCTAGGCTCTCTACT
TACAAGTTTTCTATGAGAAACCCGTCAACGCCAGAGCCATACGCCGTGTTGATGCTGTAGCCAGCGATAAGCACTACTGCTGCTATAACCGAGACCAAGT
TGCCGATGAGTCCGCAAATGGTGGCGGCACCGATCAACACGAGCCAGAACATAACCAGCACGGCCATCGCAGGCACTTGATCCTGCTGAAAAAGCGGTTT
TGCTCCGTCCGGAAGCTTACCATTCGACTCGTAAAACGCCTTCAGCAAAGACTCCTTGCGTTCAAAGCGCTTCTCCACCCACGTCGCAAGCTCGCTCTCG
CTTTTGTCGCGCAGCGACGAAATGTCCACACGCTCGAGGTAGAAGTGGATCATTCGCGGCACACGACCAGTTAGCAGCGACGTCTCCGATGGACGTTCGT
TTGCGGCGTAGTCCACGTAGAACATGGTAACATCGTATACAGCGGTGAGTTGAGAGCGCAGTAGCGGAAACATAAATGTCCAGCCTGTCGTACGCGGGTA
CAGCGAGTACTGACGTGGCGGCAGTCCGTTCTTCTCGGCGAATACAGCACTCTTATCAAGGTTACTCTTGCTCAGATCCGTACCTTCTGGGAAGAGGAGG
TATGAAGCCTCCGGTTCTGCCGACGTGAGGAACGGCAGCAACTTGCGCAGGTTCACTTGGTCATCAGCCCAGCGGCGTTGCTGTAGAGAGCAGACCCCAC
GTTAGCGCCTCACTCTCATTGCTTCCTAAAGTGTAGATGTTACCAGAAATATGAAGATGAAGTGCTGCATGGCCCAGCCGAAGATGGGGATTTTGCGCAG
AGGGGCCTTGAGGACGATACGCAACTGGTGCAGCGTACGCGTTCGCCAGGCCACACTCCACAGCAGCATCCAGTCGATGCGAGTGCGGTGGTTCGACAAC
CACAGTGCGCGGTCTTGCGGCATGTCGCTCTCGTGAGCTTTGGTCTCGGCGTCGCCGTAGACCTGCACCTGGATGCCAAACAGTTTCTCTGGCAGAAGTC
ATAGTGAGCGTCTCGCACTGCCAACGGCTTCTATAATACTTGGAAGTGGCAGATCCACGCACCCAGAAGCAGCACGACTTGACCCATCCACGCCCATTGT
CTGCTCCAATAAACACAACAACAGCTCATTGAGTAACAAACCTCCCGTCATCCTTTGTTGGGATTCCACCGACGCACATGCAGCGAGTGACGCGGCGGTA
GAAGCGTTTGGTCTGCAGAAACGCCGGCAGAGGCAGGGCCGCGAGCACGAAGCACGGGGTCAGCACCCACGCTAGGGCTGTCCAGCCCGTGAGCGCCAGC
GATACCAGGAACACGACACCCACAACGGACACTCGCATGGTCTCCGTTGCTAATTCTCAATTGATACCATAAGCATCTGATCGTAAGTTATAGGCTTATC
TCCTAAGATATGTGATACATATATTTATACAGCCTTAGGAGATATGTTACACTGTATATCCACTCGCCTTCTTCAAGATTCATTTTAGCTTTGGAGAGGC
AGAAAATGACGACGAGGGAGGAAGCGGAGCGCGACGTGAAGCTCCTCGTGAGCTTCGTGGCCATGGTCTTCGTGGGACTCGGCAACAAGAGTGCGTGCTA
GTCTCTAATCTGCACAATAAGGTTCTTGTACGGCTTAAAATCTCCCAACTGACGCACTGTTCTCCGTCCTGGATGAATCATTCTCTGCTCAGTCTTCCAG
AAGTGAGTTTTGCTACACTTGGGGTGCAGCTTTACTTGTGATTCGTATACTTAACCGATGACTTTGATAGACTGCAGACCATCCCGATGCACAACTACCC
GACGTTCCTCAACCTGCTCACCACGTTCGTCTACGTACGTGCGGCCTTCGAGTGCATGCTGTACGCTTTACTAACTGGGTGTTGGATACACTGCAGATCC
CCATCAGCTTCGCGTACATCCTACCGATGATAAAGTATGGTAGTGCCATCACGTGGGACCAACGCAGCATCCCGAAGCGGAAATTCGCCGTTATGGGAGG
ACTCGACTCAGTCGCCGGCATCCTGCAAGTGTTTGCAGCCACCTATCTGGGTGGATCGCTCATCATCTTGCTTGGACAGGCTGCGATCCCCATTTCGATG
TTGATCTCCAGTCTGTTGCTGAAAGCCAAGTACTCGGGCTACCAGTATGTTGGAGCTATGGTCGTGACGCTGGGCTTGCTGATTGTACTGGGGTCGGGCG
ACTCTGGCAGCAGCAGCGGCACCAACCCGCACCTCATTGTGCTGTGGTCTGTTGTCATGATTTTCAGCTGTGTCCCCATGTGCCTGTCCAGTGTATATAA
GGAGAAGACTCTGGGGGAGGCAGAGCTTGATGCGGTCTATCTGAATGGCTGGATCGCAGTGTTCCAGTTTCTGTGTGCTATTCCACTGACGTTCCCGGCA
GCAATGGTTGGCGACCACCCAGTCACGCCGAGTGAACTCCCGGAGAATATGTATGACGGCTTGATGTGCTACTTGGGGCAGAACACCATCACTGAAGGCG
CGCACAAGGATGACTGCGAGAAAGCGACCATCTACGTGACGGCCTATTTGCTGTTCAACGTGGCGTACAACCTGCTCATCATCTTGATCCTCAAATTCGG
CAGCGCCAACATCCTTTGGCTGGTAAGATCCTGTTGACATTTGGCCATTTGATCACATGAAGTAGCTTTCTCTGACCGTTCTTGTGTTGAACAGGCCATG
ACCATTATGGTTCCACTGGGCAACGTCGCGTTTACGTTTCCGTTTATGCCGGAGCACCAGCCTCTGCACACAAAGGACATTGCAGGCTTGCTGTTCATCA
TGCTGGGGCTGTTCGTGTACCGCTTCCTGGAGGAACTTATGGACTCTTGGAACAAGCGGAAACCCGTGTACCCGGACGAGAAGGGCCCGGCCGTAGACGA
ACTCAAGCGGGCGCTCATCAGCAGCGACAGCGACAACAGCGATGATCAAGAAGTCTAAGTAAACGGCATACAGTTACGGGTGCACTTTGCAGTGCCCGCC
ATTGTTAACGAATGAAAATCTATGAGACGTGTTACGTGTGCTAGTACTCGAAGCCCACTGCATCGTGCTGGTACAACTTACTTGACTTCAACCCGTCAAA
GTGCTGTACGCACACATATAGGGGTTAGGTGTTATGTACACCACACGCTCCACGGATGGCTATCGCTTATCGACCGCAGAACCGGGAAGACCACCACTGC
ACATCGCTGAGCATGCTGGCCGCCGCCACCAAGAGCTTCGTGCGCGCCGCGGGCGCCGCCGGGTCGCGCCGCGTGCCTCTTTTCAGTGCGCAGGTGTCTC
TCTTCTCCGCAGAAGCTTCGCCCGCCGCGCCCGAGCAGCCCAAGCGCGCCAAGCTCAAGATCCCGACCAAGCGCGCGGCGTCGCTGCTGCTGCAGCTGGA
GGCGGAGGCCGTGGCCAAGGCCGCCGAGGGAAAGGACATTGACAACTTCAAGCCCGGCGATTCGGTGGAGGTGCAGTACCTGCTGAGTCGCACGGGCGCC
CGAGTGCAGCGGGTCAAGGGCGTGGTGCTGGCGCGGCGAAACCGCGGCACGGGCAGCTCGTTCGTCATCCGCAACGTGAGTTTCGATGCGTTTACGCTGC
AGCGGTGAGAGGCTAATTATCATTTTATTGTTTGTGACAGCACATTGGCGGCTACGGCTACGAGCAGAAGATCTTCCTGCATTCGCCGCTGCTGCAGAGC
GTCAAGGTGCTGCAGGAGGCGTTCATCCACAAGGGCAAGAAGCGCGTGCGTCGTGCAAAGCTCTTCTATCTGCGTGAGAAGGCGCCCAGCTTCACCACCG
TCTAGGCGGTGCGGCTACGACAGACTCGGCGGAACCAGCAACGAAGTCGTCACAGCTACCAGTCGTGCAGATGTCTGGATGGAGGTAGCAGCGCTGCTGG
TTAGATGTAAGCGGCACGGGTAGGGGGGTGGTAGCAGCACTTAACACTAGAGAAGAAAAACGATTCACAGACCACAAGCTACAGACAGGAACAGGGTCGT
CTGTTATCGGCAAAGGGCAGCTCGTTTA