Description :
From Genome Similarity Track
Location :
Scaffold_37:66370- 74282
Transcript NameFunction/comments
Physo_135240hypothetical protein
Physo_135241reverse transcriptase

Sequence
7912 bases(100 bases per row)
TAATTTTGGGGAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGA
ATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAAT
GTATGTAGCCTTTGGTGTATCTACACCAAGGTCGAGGAAGTCTTTCGAACCCCTAACAGACGTCGTGTCTGTTAGAGTTACAAGTGACTGTAGCCACTTG
TGCGTGTAACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGG
GAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGTCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCGC
CAGCAGGCAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACCCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAGTGACGCCGTTG
ACTACGAGAGTGACGACGTAGAGATGGAAGAGGGCGAAGCCTCTTCCAACAAGCGCAAGGAGTCTATCGACAGTGATAGTCTCGACCCGCATGCCGGGTC
GAGACGCTCTCGTGAAGGAGACGATTCGGACGCTTCAAGCTCGAAGCGTTCGCGCGGCGAGACCGAAACTCCGCTCTCCGCTGCTGGGGCCTTAAGCTCC
CCGCGTGAGGTGGCGTCTTCAAGTTCTCTGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCTGTCTGCGTCAGAGATCTGTGCCTCCAAATTCCGCT
GTACGTATGCAGCGGGATCCACGATGATGCTGTGGCGGAGGAGCAGCATTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGGACTCTTTCAC
GAGCTCCGATACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCA
ACAAGAAGCCGGTTGCTTACCGTGAGCGGGTTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTC
TGTGGACGCTGGTATTCCATGCGCTGTGCCCGAAGGCCATCAGTGCACGGTGCGGTGCGCTTGAGCGACCGCGACCTAAACGGGTACACGATGATTCGTG
TACCTGAGAGTCTCAAGGATCTCCGTGCCAAGTTCTTGGCACGCGAGGAACGCGACGATCGTGGGACCTCGGGCGCTGTAGGTGACACAGCGCTCGCACT
ACCTTCGCGTCGGCAGCTTCGTACGCCCTCACCATTTCCGGAACGTCCTGCAGCAGGACGTCCCGTGGCTCCCATGTATCTTGGTGGGACGGAAACCCTC
TCCAACGAATACGATAACGAACCGGCTGCCGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAACAATCCAGTGTGTTGAGCCGCGGGCGTCGCG
GATCGGAGGCGGCGGTGGTGGGAACACGCCCCGGGTATGGTCAACCAGGGGTTGACCTTGGCCCGACGCTCGAGGAGCGGGTCGCTGCTGTGGAACAGCG
TCAAAGCCGGGAGTTCGCCGCTCTGATGCAGGAGGTGGCGATCCTGAGGGCTCAAGTCGCTCAGGCCTCGCAGACCGCATCGGACATCTCTGTCGACGTG
GGAGGTCGCATCGCACGCTTGGCCCAGCGCGTTTACGCGCTGGAGCAGAGGTTCGCTCCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTC
GTGCGGCAGGTATGGCTTCAGCCGCCCGACGTAAAAGGTCGGATGGAAGCGCATGCTAGATGGAATATCTAGCGTGTAGGCGTTGCCATGCCGTACCAAC
ACCGTGAACGGCCCGATGAAGCGCGGAGCGAGCTTGCTCGCCCCGGAGTCGGAAACTGCATGTTTAGGCAGGTTTTGAGTTGCTAACAAGACCAATGAAT
CCTTCTTGAATTCATTAGTGTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTCGACCGACAGAAGCTGCGATAGCGTCTTGGACAAACCGAATGAC
GGCTTGTCTGCGCTGCACGAGTTGATTGCGTCCAAGCTGAACTCGTTCAGCTCGTTTCTTGCAGTAGGCCCGGCCTCTGCGTTCGTCTTTGCGGTGTCTG
TGCCCTGCACAGACCCGTTCTTCTTCTTCTTCTTCTTGCTCTTGTCGACGTCTGTGGAGGGCACAGACGCGTGCTTCTTCTTCTTGTTGCGCGTAGTCGC
GGCTGACACTATGCAAGTGTCAGCAGCATTCTGCGACTGCTGCGTTGCAGTCGTAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTC
GGGAGGCGTGGGTGCCTGATGGCATTCACGTAGAACGGTGTATGCCCGGTCGAGGCATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCATGCACT
CGCTCCAGTGCTGGAACGAGTGAGCGTAGCTCTTAAGCACGTCTACAAGCACGCGGTTCACGCGCTCGGTCTGCCCGTCCGTCTGCGGATAGTCCGCAGT
CGACATCGAAAGTTGACTCCCAAGAAGTGTAAACATTTCTTGCCAAAGGTGTGCAGTGAAGCGCGGGTCCCGATCCGACACAATGTCGATCGGCATGCCA
TGGTGTTTGAACACCATGTCAACGAACAGACGCGCCGTCTGCTTCGCAGTCACTTCAGCGGGTACCGCAGCAAAATGTACCATCTTGCTGAAGCGGTCAA
CAAAGACCACAACGCCCGTGTTCCCCTGGCTGTCCGGGGGAAGACCGAACACGAAGTCCAAAGACATGGACTGCCAACACTTTCGTGGAGTTGGTATTGA
CTGCAAGGGAGCCTGCGCGAAAGGCGCAGGCTTCACACGTTGACAAACCTCGCAAGCACGGACGTACTTGCGCACCCATTTGTACTGGTGGGCCCAGTAG
AAGTCTCGCGTGAGAAGAAGGTATGTCTTCTCACGGCCCGGATGCCCGCAGTCGGTGCATCGTGATACTCGTACATGATCCTGAGTCGCAGGTCATGGTC
ATTGGGCACGACAACGCGGACCGCGTTGTCGTCGACTGCACTATAGAGTAATAACCCGTCGTGCACCCGGTAACTGTGTGCACGAGCACGAAGATGCTTC
GGCAGCTTCTGACGAGCATGGTCAGAAGGCGCTGAGCCGTAGGCCAGCAAGAGCTTCGCGTCCGCGTCGTGCGCGTACGCGACCTTCACGTCGTCCAACA
GTGACGACGTTGGGGTGCTCGATCGCATGGCGTCAATGGCATTGACGTCGGCATCAGTCGTGGCGTAGTCAGGTCGACGCGAGAGCGCGTCGGCCACCAC
ATTGAGTCTTCCGGGTTTGTACTCAACCCGGAAGTTATACTCTGCGAAGAATGAGAGCCATCTCGCCATCCGTTGCGAGATGTGCGGCGACTTCACAGCC
GTCCGCAGTGACGCGTGGTCCGTATAGACCACGAACGGTTTGCTTCCGAGTAGATACACTCGGAACTTCACGAGTGCGTACTTCATGGCAAGGAGTTCCT
TGTCATGTACCGGGTAGTTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAGACGACACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACA
TCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTTGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCA
TCGAAGGCCTGCTGACACTCAGCAGCCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGTGACAGCGGGCGTATCATGCCCGCGTAGTCCTTCACGTACT
TGCACAAGTACGTGACCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCGGCCACTCATTGATCACTCTGACCTTCTCAGGGTCAGGGCG
GACACCGTTCTTCCCAACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCACTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATAAGC
GCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCTCGTCCGCAGCCCGGCTGTGGACGAACACATCGCCGAAGTAGCTCGGTGCGA
AGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCTTCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCC
GCTCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAACCCATCGCGCAGATCAAGAGCACTGTATATAGTGCTCCTG
GCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCATCGTTCAGCTTGTTATACGCATGAACGATGCGTCAGCCGC
CCTGTGGTTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTTGTCCAGCTTTGCGACGACTTCGAAGAAGTCGTCGATCGCT
TTGACCTGCTCTCGCGGCAGTGGCCACTGCCGGTGACACAGTACTTCGTGCCCGGCACGAAATCAATCTCGTGCTGGATTCCCTTGTCCTGCGGAAGCTC
CGCAGGAATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGACTCGTCTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCC
TTCTTCATCTTTGCACTGAGAGTGTCTTCACTCTCAGTGGTGGTCTCCATGAAGAACTGCCTCAGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCG
AGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAGCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTCGTCGGA
GGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACGTTCAACGTCTCGACGTCCGGCTTCTCAGCCTCCGTCTGCCCGG
CAGACATTCCTTGTAGCGTCTCGACCCCAGGCCGAGACTTGCGCAGCGACCTTCGCATGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTC
TTGACCTCGTCCAGGCCCAGCCATGGACGGGTGTTCCTCTTCAATACCGCCGGCGGGTTCATCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCC
GGCGCTTCGTCGTGCAGCCCGGCTGCATGACAGCATGCAAGTTTTTCCGGTGCGGAACGTTTGCAACCGTCCGCACCGCCTGCAGCGTCGGCTTCCGGAG
CCGACACGCCATCTTCACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCC
ATCGACTCCCGGAGTCGACGGCGTTACGTCACCTTGGCTCTTATTATTGGCCAGACCTGATCCAATGAGCTTCGCGTCAGCCTCCACGGCTGAGGCGTGT
GACTCGTCTGTGTCATCCGTGCCCCTTGAGGTTGGAGACTCTTCCTGATTCGCTGAAAAGCGGGTGTCGATCTCCGAGATCAACACATTTTCTCCTTCAG
CCGTCGGCGGCGACGCCGACGCTTGCTGCTCTTGCTCGCGTGCGCCCAGGGCGCTCCTGGACAGCGGCATTAGGCGCTGTCTCGAGTGGGGAGTCGCGCG
CACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGTTCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACCGG
ACCATGCCGTGCAAGCCACGGCATGCCCAATACAATGTCAAACTTATCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATCTTCGTACGTG
ACGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACGGCACCCGTTGCCAGTCGTACTTCCAACATACTTCGAGGTATCTTTAAATCCTCGAAGTCAA
GCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGAATCTACCAAAGCACGTAGAGAGCCACTTGCTCTCATCGAGTCCACATTCAGGAT
GACAAGGTCAGGCTTGTCATCTTGGTTCTTGCAGTGAGAATGAACCTCACTGGGGGCTGCAGTCCTCAGTGTCGCGTGTCCAAGGTCGACACGCGGAACT
GCATTACCAGTAGGGCGCCCCGCGCCTACTGGCGTCCATCGTTTTTTGTTTGGTTGCGACGGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTACAC
GGGGGCCGTGCACTCCCGAGCAAAGTGACCGACTCTACCACAACGGTAGCATCGCACATTGTTTCCCTGCGACTGCTGGGGTCCAGCAGTTGCAGCACTC
GAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCGTGGCTGTGGCCTGGGCACATGTGCATGCAGCTTAGCCTACCGCAGGCTAGTCTCCT
CCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTATTCGGATACTCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTCATGAACGTGAC
GACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTCTGAGCGTAAACATGGACATCATGCTTGCCCTGCTGCAGG
TCGAGGAACTCCGCCCTCGACCCGAACTCGTTTTGCAGTGGCTCAAACGCTTGTCTGAGCTCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGAT
CCGAGAGTCGGCGTTCATACGCCCAACTTCTTGCACGTCCGCCAAGACATGACATGGTGAACGCGACCTTCGACAACGGGTCGACGATGCGTCGAGCCGC
AATGGCAGTGTCGAGTTCGACAAGCCAACGGAGGAGAGGCTCGCCCTCTCTTCCAACGTAATTGCTCACGCTGAGCTTCAGCGATTGCGCGCGCGGTGTC
GTCCCCGACGACACCGTGGTAGACGAAGCAGCATCTCGCTGCTCCCTCATGATGAATCCCAGAGCAACACCATGTTGCTCTGTCGGCGTTAGCGTACGCA
GCATCGTAGCTACAGCCGCCTCACCAATGACTGTTGACAGTCGTTGGAGAGCTTCCCACACTGGGTCCGACAGGTGGGGACAGACAGCGCGTGCATCGTG
AGTTACAGGCGTAGTGGAGCTTTCCATGGACACCTCCGTATCCATGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGT
CGTTGGACGGACTACAAAGTGCTACCAGGTGTAGTGGACCTACTTTGGCTCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCTTA
GTTTAAATTAGAGTTAATTATACTCGGGCCTTCGAGTATAGATTAATCTAAATAAACGATCCAGATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTT
TGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCATGTCGCTCATTGG
CTAAGAGATGCTGCCCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAATGTATGTAGCCTTTGGTGTATCTACACCAA
GGTCGAGGAAGT