Description :
From Genome Similarity Track
Location :
Scaffold_37:66370- 67599
Transcript NameFunction/comments
Physo_135240hypothetical protein

Sequence
1229 bases(100 bases per row)
TAATTTTGGGGAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTGGTTGGCAGA
ATTCCAATGCTATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTGGTCGTAAAT
GTATGTAGCCTTTGGTGTATCTACACCAAGGTCGAGGAAGTCTTTCGAACCCCTAACAGACGTCGTGTCTGTTAGAGTTACAAGTGACTGTAGCCACTTG
TGCGTGTAACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTCTTCACGTTGG
GAGAAAGAAAACTCGAGCTCATTCCGCAATGAGCTCGCCGCAGAAGAAGACCGTCGCCGCAACAGAGGGTAACCTCTCTGTTGCTCAGTACCATGAGCGC
CAGCAGGCAAAGCGCGACGCGCTCGCTGCAAAGGCCGCGTCGGGGACAACCCAGTCGGAGATTGTCCTCGAAGGTTCCTCTGTAGTCAGTGACGCCGTTG
ACTACGAGAGTGACGACGTAGAGATGGAAGAGGGCGAAGCCTCTTCCAACAAGCGCAAGGAGTCTATCGACAGTGATAGTCTCGACCCGCATGCCGGGTC
GAGACGCTCTCGTGAAGGAGACGATTCGGACGCTTCAAGCTCGAAGCGTTCGCGCGGCGAGACCGAAACTCCGCTCTCCGCTGCTGGGGCCTTAAGCTCC
CCGCGTGAGGTGGCGTCTTCAAGTTCTCTGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCTGTCTGCGTCAGAGATCTGTGCCTCCAAATTCCGCT
GTACGTATGCAGCGGGATCCACGATGATGCTGTGGCGGAGGAGCAGCATTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGGACTCTTTCAC
GAGCTCCGATACTTCTCCAGCAAGAAGACCTCTTCTCGCAGCAAAGTGCCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCA
ACAAGAAGCCGGTTGCTTACCGTGAGCGGGTTAAGCATGCCCGTGAGCGCTTCGAGACATTCTCGACGCGCGGGAGGCTGGAGCAGCTCCACAGATCCTC
TGTGGACGCTGGTATTCCATGCGCTGTGC