Description :
From Genome Similarity Track
Location :
contig_28:6637- 10960
Transcript NameFunction/comments
g5551.t1hypothetical protein PHYSODRAFT_522429
g5552.t1hypothetical protein PHYSODRAFT_523388
g5553.t1conserved hypothetical protein

Sequence
4323 bases(100 bases per row)
TCAACCTCGCTCTAAATTCCGAGGTTGAAGTTCGCTCTGTACTCTTACTGAATAAATGCTGAATTTTTGTCCCCACGACTGGAAGTACGAAGAAATCACA
AATTCTGTTTTTAAATTTTCAAAATAACCACATTGAAGCGGCATTGCACCATCTTGGTCGGAAATTCCTCTCGTTCAAAATTAGCGGAGAAAAACAAGCT
TTTTAGAAATGTCAACATTTGTATCTCAAGCAACTACATCTGCTTCGGTAGCAATGCGACTTCTATCGACCAAATCTAGGCTCTCTACTTACAAGTTTTC
TATGAGAAACCCGTCAACGCCAGAGCCATACGCCGTGTTGATGCTGTAGCCAGCGATAAGCACTACTGCTGCTATAACCGAGACCAAGTTGCCGATGAGT
CCGCAAATGGTGGCGGCACCGATCAACACGAGCCAGAACATAACCAGCACGGCCATCGCAGGCACTTGATCCTGCTGAAAAAGCGGTTTTGCTCCGTCCG
GAAGCTTACCATTCGACTCGTAAAACGCCTTCAGCAAAGACTCCTTGCGTTCAAAGCGCTTCTCCACCCACGTCGCAAGCTCGCTCTCGCTTTTGTCGCG
CAGCGACGAAATGTCCACACGCTCGAGGTAGAAGTGGATCATTCGCGGCACACGACCAGTTAGCAGCGACGTCTCCGATGGACGTTCGTTTGCGGCGTAG
TCCACGTAGAACATGGTAACATCGTATACAGCGGTGAGTTGAGAGCGCAGTAGCGGAAACATAAATGTCCAGCCTGTCGTACGCGGGTACAGCGAGTACT
GACGTGGCGGCAGTCCGTTCTTCTCGGCGAATACAGCACTCTTATCAAGGTTACTCTTGCTCAGATCCGTACCTTCTGGGAAGAGGAGGTATGAAGCCTC
CGGTTCTGCCGACGTGAGGAACGGCAGCAACTTGCGCAGGTTCACTTGGTCATCAGCCCAGCGGCGTTGCTGTAGAGAGCAGACCCCACGTTAGCGCCTC
ACTCTCATTGCTTCCTAAAGTGTAGATGTTACCAGAAATATGAAGATGAAGTGCTGCATGGCCCAGCCGAAGATGGGGATTTTGCGCAGAGGGGCCTTGA
GGACGATACGCAACTGGTGCAGCGTACGCGTTCGCCAGGCCACACTCCACAGCAGCATCCAGTCGATGCGAGTGCGGTGGTTCGACAACCACAGTGCGCG
GTCTTGCGGCATGTCGCTCTCGTGAGCTTTGGTCTCGGCGTCGCCGTAGACCTGCACCTGGATGCCAAACAGTTTCTCTGGCAGAAGTCATAGTGAGCGT
CTCGCACTGCCAACGGCTTCTATAATACTTGGAAGTGGCAGATCCACGCACCCAGAAGCAGCACGACTTGACCCATCCACGCCCATTGTCTGCTCCAATA
AACACAACAACAGCTCATTGAGTAACAAACCTCCCGTCATCCTTTGTTGGGATTCCACCGACGCACATGCAGCGAGTGACGCGGCGGTAGAAGCGTTTGG
TCTGCAGAAACGCCGGCAGAGGCAGGGCCGCGAGCACGAAGCACGGGGTCAGCACCCACGCTAGGGCTGTCCAGCCCGTGAGCGCCAGCGATACCAGGAA
CACGACACCCACAACGGACACTCGCATGGTCTCCGTTGCTAATTCTCAATTGATACCATAAGCATCTGATCGTAAGTTATAGGCTTATCTCCTAAGATAT
GTGATACATATATTTATACAGCCTTAGGAGATATGTTACACTGTATATCCACTCGCCTTCTTCAAGATTCATTTTAGCTTTGGAGAGGCAGAAAATGACG
ACGAGGGAGGAAGCGGAGCGCGACGTGAAGCTCCTCGTGAGCTTCGTGGCCATGGTCTTCGTGGGACTCGGCAACAAGAGTGCGTGCTAGTCTCTAATCT
GCACAATAAGGTTCTTGTACGGCTTAAAATCTCCCAACTGACGCACTGTTCTCCGTCCTGGATGAATCATTCTCTGCTCAGTCTTCCAGAAGTGAGTTTT
GCTACACTTGGGGTGCAGCTTTACTTGTGATTCGTATACTTAACCGATGACTTTGATAGACTGCAGACCATCCCGATGCACAACTACCCGACGTTCCTCA
ACCTGCTCACCACGTTCGTCTACGTACGTGCGGCCTTCGAGTGCATGCTGTACGCTTTACTAACTGGGTGTTGGATACACTGCAGATCCCCATCAGCTTC
GCGTACATCCTACCGATGATAAAGTATGGTAGTGCCATCACGTGGGACCAACGCAGCATCCCGAAGCGGAAATTCGCCGTTATGGGAGGACTCGACTCAG
TCGCCGGCATCCTGCAAGTGTTTGCAGCCACCTATCTGGGTGGATCGCTCATCATCTTGCTTGGACAGGCTGCGATCCCCATTTCGATGTTGATCTCCAG
TCTGTTGCTGAAAGCCAAGTACTCGGGCTACCAGTATGTTGGAGCTATGGTCGTGACGCTGGGCTTGCTGATTGTACTGGGGTCGGGCGACTCTGGCAGC
AGCAGCGCACCAACCCGCACCTCATTGTGCTGTGGTCTGTTGTCATGATTTTCAGCTGTGTCCCCATGTGCCTGTCCAGTGTATATAAGGAGAAGACTCT
GGGGGAGGCAGAGCTTGATGCGGTCTATCTGAATGGCTGGATCGCAGTGTTCCAGTTTCTGTGTGCTATTCCACTGACGTTCCCGGCAGCAATGGTTGGC
GACCACCCAGTCACGCCGAGTGAACTCCCGGAGAATATGTATGACGGCTTGATGTGCTACTTGGGGCAGAACACCATCACTGAAGGCGCGCACAAGGATG
ACTGCGAGAAAGCGACCATCTACGTGACGGCCTATTTGCTGTTCAACGTGGCGTACAACCTGCTCATCATCTTGATCCTCAAATTCGGCAGCGCCAACAT
CCTTTGGCTGGTAAGATCCTGTTGACATTTGGCCATTTGATCACATGAAGTAGCTTTCTCTGACCGTTCTTGTGTTGAACAGGCCATGACCATTATGGTT
CCACTGGGCAACGTCGCGTTTACGTTTCCGTTTATGCCGGAGCACCAGCCTCTGCACACAAAGGACATTGCAGGCTTGCTGTTCATCATGCTGGGGCTGT
TCGTGTACCGCTTCCTGGAGGAACTTATGGACTCTTGGAACAAGCGGAAACCCGTGTACCCGGACGAGAAGGGCCCGGCCGTAGACGAACTCAAGCGGGC
GCTCATCAGCAGCGACAGCGACAACAGCGATGATCAAGAAGTCTAAAGTAAACGGCATACAGTTACGGGTGCACTTTGCAGTGCCCGCCATTGTTAACGA
ATGAAAATCTATGAGACGTGTTACGTGTGCTAGTACTCGAAGCCCACTGCATCGTGCTGGTACAACTTACTTGACTTCAACCCGTCAAAGTGCTGTACGC
ACACATATAGGGGTTAGGTGTTATGTACACCACACGCTCCACGGATGGCTATCGCTTATCGACCGCAGAACCGGGAAGACCACCACTGCACATCGCTGAG
CATGCTGGCCGCCGCCACCAAGAGCTTCGTGCGCGCCGCGGGCGCCGCCGGGTCGCGCCGCGTGCCTCTTTTCAGTGCGCAGGTGTCTCTCTTCTCCGCA
GAAGCTTCGCCCGCCGCGCCCGAGCAGCCCAAGCGCGCCAAGCTCAAGATCCCGACCAAGCGCGCGGCGTCGCTGCTGCTGCAGCTGGAGGCGGAGGCCG
TGGCCAAGGCCGCCGAGGGAAAGGACATTGACAACTTCAAGCCCGGCGATTCGGTGGAGGTGCAGTACCTGCTGAGTCGCACGGGCGCCCGAGTGCAGCG
GGTCAAGGGCGTGGTGCTGGCGCGGCGAAACCGCGGCACGGGCAGCTCGTTCGTCATCCGCAACGTGAGTTTCGATGCGTTTACGCTGCAGCGGTGAGAG
GCTAATTATCATTTTATTGTTTGTGACAGCACATTGGCGGCTACGGCTACGAGCAGAAGATCTTCCTGCATTCGCCGCTGCTGCAGAGCGTCAAGGTGCT
GCAGGAGGCGTTCATCCACAAGGGCAAGAAGCGCGTGCGTCGTGCAAAGCTCTTCTATCTGCGTGAGAAGGCGCCCAGCTTCACCACCGTCTAGGCGGTG
CGGCTACGACAGACTCGGCGGAACCAGCAACGAAGTCGTCACAGCTACCAGTCGTGCAGATGTCTGGATGGAGGTAGCAGCGCTGCTGGTTAGATGTAAG
CGGCACGGGTAGGGGGGTGGTAGCAGCACTTAACACTAGAGAAGAAAAACGATTCACAGACCACAAGCTACAGACAGGAACAGGGTCGTCTGTTATCGGC
AAAGGGCAGCTCGTTTAGTCAAG