Description :
From Genome Similarity Track
Location :
Scaffold_173:66367- 68130
Transcript NameFunction/comments
Physo_144233gag protein

Sequence
1763 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGACTGGTGACTGCTGTTCACCTGGATAGTAATATCCGCACGCACTTCC
TCTGTGCATTGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGTCTACCTGAATCCTCGGTGGCTC
AGGTCTGTGAGCCACGATGGACCGAAGTGAGTTTCCTCACTTGACTGACTCGCAGTTCGAGTCGGTGCGGAAGATGGCGGGCATCTTCGGAAGAGATGCC
CTCCGGAGCTTGGCGGCGGCGACGCCAGCCGAGCAGGTCGAGCGGGTGAGCGCGTTTGACGAGTACGAACGCGGGCTCATCGCTCATGTGCAGGGAAACC
TGCTGGCTCAGATGAGTGAGCCCAAACGGGTGCAGCCTAAGCCTCTGCGGCTAGCTGTGCCTCCGTTCGAAGGGAAGGAAGGTGAGAACCTTCACTTCTG
GATCCGGGAGACCGAGATCGCAATGAGCGCAGGTCTCATCTCGGCCGAGAACCTTCGAGTCGCCTTCGCGCTCTCCAATCTTGGCGGACGTGCCAGGACT
TGGGCGTATACGCGCGAAGCGATGTCGCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCTTTTCTCCCGGCGAACAACGAGT
TCCGCCAGCGCTCGCGCTTCCTTGCCTGCAAACAAGGGGAGCACGAGCTGTACGCGTACGTACACGTTGGCAACCTCGCTGGTGGGGAACCCACTGTCGG
AAGACGTCAAGATGACAGTCTTCGTGGACGGCCTGAAGGTCGGTCCTGTGCGCACGCAGTTGTTCCGTGTGCGCACCGCCACTATGGAGGAGGCGATCCA
AGTCGCCCTCCAGGAAGAGTACAGCCACAAGCAGGCTGGTGCTCTGGCTGTTGTACAGCCTGTGGTCACTGACAGCGAACCAGAACCCATGGATCTGAGT
TCGGCTGAGCAGTACTCAGCCCGCTGCTACGGCTGCGGCGGACTAGGACACTATCAACGTGTCTGCCCATCGCCTGGGTCTGGGAAGAAGACCTACCCGA
AGACCAGAGGGTCAAGGGGACGCCGACGCCATGCACCGTCAGGTGCTCAAGGGGGACACAACCACCAGTAAGGACGAGGGCTTTGCTGGGGTTGGCCCGA
GTCTTTGTGATGGGTGTACGGAAGGCGTACACCACAGAGACCCGGGGTCCCTTGCGAGCACTGACGCTCGCATTGGTGAAGGACAACGGTGGGTTGTCGG
TAGTACACGTGAGTGTGCGGGGGTAATGGTATCCCTAGACATGATTGAGTCTGGGACGTCGCGTGGATGTTCGCACGTCGCCAGATGTGTCGGTTGGAAT
AACGACACAAGTGCCGAGACTCTGCGAGAGAGTCTAAGCACAAGGTCAGGTCTCATTGACTGAGGCTGGGCCGAAGAAGAACCTTGGGGTCCGCTGTGAC
CCTGGCTGCCGCGCTCGAGGGCGCTGACAGCAATGGAACCGCACATGGTCCCGGACATGGAACCGTACATCGTCCCGGACATCGTGCCGAAGCCGGCCCT
GGGCATGGAACCGTATATGCCCTCGTCTTGAGCAAGTATGACTTGGCCCTGCGTGCGCCGTGCAAGCTGCACAGGCTCTCGGTCGAGTAGCGCGACAACG
CCTTGAGGCTAAGTCGGCCCTCTGTGTCTGACAGAGCATTGGTGAGTCATGTTCCCACCTCTG