Description :
From Genome Similarity Track
Location :
Scaffold_313:6635- 8466
Sequence
1831 bases(100 bases per row)
CTTCAGGCTGACCGCCCGAAAGATGTCACAATATGGAAACAAAAGCGACGGCAGCTTCGTAAGTAGTCCGAGGCGTCCTTCTCGAACGAGGTACGGAAAT
TGACGACACTGTGTATCCGCGCTCATCGTGGACGCTAGAAGCCGGGCGTTTCAGGATGGCCCTTGATCTTACTAACCAAGTGGGCAAACCGACACAAAGA
TCGTGCTGGCCCAGGAAACGGGACAGCAACCGATCTTCATGGGACTCCCGTAACTCCACGGATGAGTACTTGAGAGTTTTAACCCACTCCCAGAACATGG
ATTCTCATGCGATTTAGCTTTTACAGCTCTCGGGAAGATCTCCGGGCTAGCGCCATCCAGGTTAGATACCACCCCGGTTCTCAGGCTTCTTACGACAAGT
CGTAAAGTCCGTAAGAGCGATTCGGCTCTGTGCGAGAAGCTCGCACCATGATGCCTCCATGCTCTCGGTGAACAGCTTATCCTTCTGAAAAAGGGCGCAT
TTTCTCTAGAAAGAGGTCGCCGTTAAGCTCTCCTCGGGAGGCCAATAACCTCTCGTGAAGCTGGGAGCTTCCTAGCTGACTGGTGTCGTCACTGGACCGC
CACGCATACGCTAGGCAGCTTGGATGTCCTCCTGCTGCTGGTCAAGATCGTTCGCGATCTCCTGGGGCTCATGGATGACACCCTTCTCTTCCTATTCATC
CGATGAATCGAAGAGGTTCCGATTGGAGTACCCAGTCTCCTTCTTCTCACGAAGTGGAGACTTCGAAGCCGTGCGCTTCTTAGAGGACTTGGCGCCTTCG
GCTGTGGCCTTCGTAGCCTTAGAGTGTGCAAGGCTGTCGGCACACGAAAGGTTCTTGAGATGTTTCTCTTCCTCGCCATCGCCAGCTTCGAGGTATCCGT
TAGCCTTGACGGTAGGACTCTCAGATCGCTCAGGTGTCTTAGGGTCGTGATCACCGCGATCCCTAATACGCGAGTGCATACTGTCGTCGTCGTGCTCGCT
TGGCGAGAGTGTCTTCTCCCACGAAGCTCGTAGGGAAACTGTGGAGACCCCTGACCTCAGCCTCGTTCTCACTACCCGAGCTGAGATCTCGGTATGTGAA
GCGCGTACTCGGACGGTTGTCTAAAGACACCGAAAGTGACAGACTGCGGCGTTTGCTAGCGCACTTGCATGCTGCCGTGTAGCCGAGCGTAAATAGCGCA
TCAGCGGCCACCTTAGTAGCCTGCTAGAGTGCAGATCCTTTGCCGCAAGGTTTAGTGCTGCTGGTTTGCGCTTTACGGCGGCAGCCTTGGCTTGTGCTTT
CTCACCGCTTTTTGTAGTACCACAGGTCATGCCTAAGGTCGAAATGAAGACCGAGAAGAAGGTCACGTGTGTGCTGCTCGGGACTCTAACAGTGAAGTGA
GCCACCGCCACGTTCTCGCAGCCAAATTGATGTCTTTCAGCTTTGAGAGCGAGAGTTCGTGACGTACTCTCTCTCATTCTGATAGGTCGGTAAATTAAAC
TTAAGTGGGGGAATGTAACGAGGTACAGGCCAAGTCTACCCGGGCTACATGAAGCATGACCCGACACTCTTCGATATACCTGGTGCATGGTATCAAGGGC
TCTCGAGGCCAATCATTAGCTAAAAAACATAGCTTTCTTATCGGTGATTTATTGTTTGTTTAGTGAACTCAAGCTTAGACTACCTTCAATACACTTAGTC
TGAAACTAACTCTTAACTTTTTATTATACTCCCTTTGACAAGGGACCTGTAAACTGATGTTCGCTTAGAGTTTGGACACACTCGAAAGCCGACTTTCTCA
AGCGCAAAGTACTGTGGGACGTCCCTTCACA