Description :
From Genome Similarity Track
Location :
Scaffold_210:66341- 69186
Transcript NameFunction/comments
g10644.t1hypothetical protein

Sequence
2845 bases(100 bases per row)
CGTTGGTGGGATACCCGTGCGGTGCACATGCTGAGCACCGGTGGTAGTGTGGAGAGTGATCGAATCGTGCGTCGAGAGAAACTGACGGGTGAGCAGCAGA
CTCAGGTTGCGTGCCCGCGAGTAGTAAAGGATTACCAGACGTTCATGGGCGGTGTGGATGTTCATGACCAGCTGCGACTCCAGCGGTAAGTGTCGCTATC
GTGTACATCTGCCTTACCCTACCTGATAATAATGTATGATACACGCAACAGGTATTCGCTGCAGCTTTGCATCAAGTACAAGAAGTACTCCAAGTCCTTG
TTTCTTGGACTCACAGATCTAGCCATTATCAACGGCTACATAGTCTACGACGCTCGGCGCGCAGCCGCAAATCTCTCCAAGGTTCGCCATGTGAAGTTCA
TGAAGCAGCTTCATCTGGAACTGTGTCAACTCCGTGAAGAAGACTTGGAGCTGCTACGAAGCAACGAGAATCTTCAAGTGACACCACAGAAGACAGCAAA
CAGCAGTAGGATCCGACGGTCCGCCCACAAGCCTCTGCAGAATGATGAATGTCGCCCCGGCAACAATGGAGTTGGAAGGAAGAGACGCACAAGAGCCTGC
AAGATATGCGCACTTCTGAAGGGCACTGATAATGCTCGTGGCGGCGATTCGTCCGTGTACAGCAGCAAGTGCAAGCTACCCACCACAAGTAAAAAGCCAA
TGGCGTGGCGAGTGTTTTTGTGTGAGAAGATGCGCCACGCTGTGAGCGGGCAGCCGATGTCCTGCTTTGGTAGTTGGCATAAAGCTTTGCGGGATGGTAC
ACTCGCACCAGCGCCCAGACGCGACGGAAAGAAGCGTATGATCCGTGCTCAACGTCCTGCAGAAAGCCAAGTGAACGAAATGAGCGAACTCGAAGAGGAG
GAGGAGCAAGCGTGATAAGTCGACGGCGGACGGTCCCCACCAGCCGAAGCGGGCTCGTCACGCAACGGAGCAAGAGACGACTGACTGAACTGCTGACTGT
GTCCTTCGTTTCATATTGAGTTTTTGTATACTGCAATGCCACGCAATCCAACTCAATTGCATCTGTTCTTGCTACTCTCTGCTATACACGCGGTAGTCGC
GGCTGTGTTTGCGGCTTTCATGACTTTACCACACAACTTGGCTTTGTTTTATGCACAACATACATGATAACGCTCGTACCTTGTATTGATTAGTACCTCT
AATTTGGAGCATACACGATAGAGAGCAACACACCAATCGTGGGTTAGGTTTAGCTTGAGGCTATCTATTATACACGTTACCAAACATATAGACTTTTTTT
GTATCCAACCCTTACCGTGACATACACGATAGAACGAGTAGGGCTTAGGTTGGTGGGAGAACGAAAACACGTCCGGGCTCAAGGGGTTAGCTTGAAGAAC
GAATCGCTGCTTGGAATTCACCTGGATACCATCAACGCACTGTGCGCAAAGGTTTCACTCGAAAAAAGGACCACCAGCACTCGTTTGAAGAATCTTGAGG
TGGGTGGTGTTGCGCAAGCATGCTCATCTATGTTGCTGCATAGTCTAATACATCGAGCAGCAGGAGTCTGCTGCAGATTAAACGGCAACATCGAATTCCT
GACGGACGCCACGATGTAGAATCAAGTGTAAACGTGGAGCCTCTCAGTGGCACCAAGGTCTCTTACTGCAATAGCAGACTACCCGACGCGATCAAGCGCT
AGAATCAACAATTCTACGAAACAGCAAAATAAATACTACGTAATACATCTTTGCTTTGTTTTATTGTTTTGATGCTAGATACGTCAATAAATAAATTGCA
ATTTGGGCCGGTTTGAGCTATTTCTGAAAAAAATATCCGCTAGCTTTCTCTAACTTGTGATATTATTCACTAATGTATTGCTGAAACGAGCACAGACAAC
AACTAATAAAGCCGGCAACGCAAAACTCGGCATGCAACAGTGGCACGTCTTCATTTTCTACATTTTTTTTAGTTTAGCCAATAGATTCCAGGAATTTACT
TTTTTAAATATCAATTACAAAACTCCCGCTCATGAGTGCCTCAGACAAAACGATCGTAAAGCTGCATTAAAACGCTGCGTTCCAAAAAAATGCCTCGACC
CAAGCAAAATAGCTACACAGTGAAGGAGAAGCAGGTCGGCGTCCTGCTTGCACGGGATGTGGGGGTTCAGGAGGCGACACGTGTCCTCGGATATCCCCGA
GACTCCGTTTACACCTGGAAGCAAGCTGAGCGCCTTCTGGACTTCCGTAGCCTGAAGACCTCGAAGACGCTCAAGGGCCAGGGACGCAAGGAGATATATC
CCAGCGTCTCTGCCGTTGTAACCTTCATGAAGGATGTAAGGCGCGACGAAAAGGTAATATTTGTTTGTTTTATTCTGGCAATTCTTCCACTTTAACGTTT
GTGTTTTTATATTTGGTTTTACAATATTGTTCTATAGGTTCTATCAACAAATGCTATTATTGACCAGATGTGCGCAGAGGACCCCGAATGGGTTACGGAG
TACATTGCTAGCAGGAAATGTGGTGTCCTTCGGCTAGAGCGCCTCTGCTAGCGCCTCGCGAATCGGTTAGCCATTAGGTTGTATTATTATCCATCAAAAA
ATGATTTTTAGTGTTGTTTATAGCCGCGGGTTTTCATCACAGAAACCCCAAGGCGGCAAGAAATCGCTGGAGGAGCTCCAAATGGTTCGGGCTGAGTTTG
CCCTTTCGTTTTGGTCACAGTACACCCAGTATCAGAGTGGTGGTATACTCAATGTTGATGAGACCGGCATCAACTTTGATATGCCACCACTCCGCGCCTG
GGCTTTGAACGGCCGTACAGACCCCGTCCATATCATCGGGCTGAA