Description :
From Genome Similarity Track
Location :
Scaffold_63:66333- 68259
Sequence
1926 bases(100 bases per row)
AAACGATTTACGTAGGTGGCTTGGGCTTACGAATTACTTGAATAAGTATAGCGAGAATTACGCTGATATGGCTCGGCCATTGTTTTTAATCTCGTTAAGA
AGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGATTTTTAAGCAGTTAAGGAAAGTCTCCTTCATACGCCAATACTGGCTTTTCCCGATCCTGA
TCGGCCTTTCAGTGTCGTCTGTGACACATTTGACTTTGCCATAGGCAGTTCTCTGTTACAAACTGATGTCGATGGACAAAAAGCGTCATTGCATTCGAAT
CTCGACATCTCAAAGCTGCTGAAAAGAACTTTCCAGCATGATAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTCGAT
CAAAGCCTTTTGTGATCTATACAGATCATGCATCATTGCGCGCTGCGACACAGTCGCCGCATCTCTCTCAGAGTATGGCTCGTTGGCTTTCATTCTTTGC
CGAATATAACTTCGAAGTGAAGTTTAAGCCAGGAAAGCAAAATTCTTTGGCTGGTGTGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTACG
CTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGACAAGGATGAACAATGTATAGCTTTGCTACGTGCTCTTGGGAGCGAGGAGTTTAAAGACT
CGGACATAGACTTTTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCCTGTTGTACTATCGCACAGATATTGAGGATAACCCTCG
TATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGAACTATAGC
TCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGAGCTCAGCACAGGAGGCGGC
GCCCCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATGATTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGTAAGGCAACACTGGCATT
ATGGTCTTTGTTGAACGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTCAATTGATGCCGAAGGTACAGCGAAGCTATTTATCGACCCTGTGT
CTCGACAACATGGCTTTTCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCACTGGCAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGTTT
GGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCATACTGAGCGTGTTGATCGCGTCATTAATGACATTTTGCGCAGTGTTTGTGCTGATACGCCT
AAGCGTTGGAGCTCCATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTACAGGCTATACTTCATTCTACGTAAACGGTCTCACCC
ACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCAGGGCTTGATTGGGGAGAGGTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTGTTCAAAA
ACAGGTAAGCGAGTTTCTCGCAACGCGATTGAATATCTTAAGACATTTTCGTGACGCAATGGCTGAAAGCCAAGACCAACAAAAACAACAAGCAGATGCT
AAAAACAGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGCGAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTTTAAGATA
AAGTTGCGTCCACGCTTCATTGGACCATTTACGGTCACTGCCAAGAAGGGACTTGCATATACGCTAAACCTTCCGCGCAAATTGCGCACACACCCAGTGT
CATACGTAGGCTTACTCAAGCCATAC