Description :
From Genome Similarity Track
Location :
Scaffold_63:66331- 68268
Sequence
1937 bases(100 bases per row)
CAAAACGATTTACGTAGGTGGCTTGGGCTTACGAATTACTTGAATAAGTATAGCGAGAATTACGCTGATATGGCTCGGCCATTGTTTTTAATCTCGTTAA
GAAGGATGTGGATTGGTGTTGGGGTAACACCGAACATGATGATTTTTAAGCAGTTAAGGAAAGTCTCCTTCATACGCCAATACTGGCTTTTCCCGATCCT
GATCGGCCTTTCAGTGTCGTCTGTGACACATTTGACTTTGCCATAGGCAGTTCTCTGTTACAAACTGATGTCGATGGACAAAAAGCGTCATTGCATTCGA
ATCTCGACATCTCAAAGCTGCTGAAAAGAACTTTCCAGCATGATAAAGAGCTACTTGCTATGAAGTACGCTCTAGTCAAATTCAGAGTACATCTGCTTCG
ATCAAAGCCTTTTGTGATCTATACAGATCATGCATCATTGCGCGCTGCGACACAGTCGCCGCATCTCTCTCAGAGTATGGCTCGTTGGCTTTCATTCTTT
GCCGAATATAACTTCGAAGTGAAGTTTAAGCCAGGAAAGCAAAATTCTTTGGCTGGTGTGCTATCGCGCCGACCTGACTATGAGCTTGCTCACGTCACTA
CGCTGTCATCGTCAGTCACTGACTTAATCCGTGCGGCTTATGACAAGGATGAACAATGTATAGCTTTGCTACGTGCTCTTGGGAGCGAGGAGTTTAAAGA
CTCGGACATAGACTTTTCGGCACGTTTACGTGCGAGGCTACATCGATATTCTATCGATAATGGCCTGTTGTACTATCGCACAGATATTGAGGATAACCCT
CGTATCGCTGTCCCTCATGATGAGGAGTTGAAGTATCGAATCCTCTATGAGGCACATGATACCGCTTTAAGTGGTCATCTCGGTCGTGAGAAGAACTATA
GCTCAGTGAGCCAGGCTTATTGGTGGCCCAAACTATACAAGTGGGTGAGCACCTATGTGCGTACGTGTGAAACGTGTCAACGAGCTCAGCACAGGAGGCG
GCGCCCCTGGCTAGTCTGCCTGTACCCACTGGGTGTTGGGAGTCCATGATTATGGACTTTGTGTTTGGCCTACCGAAAGATTCGTAAGGCAACACTGGCA
TTATGGTCTTTGTTGAACGATTGAGCAAGATGGCTCATCTAGCGGCAGTGCCGGACTCAATTGATGCCGAAGGTACAGCGAAGCTATTTATCGACCCTGT
GTCTCGACAACATGGCTTTTCAGTGGCAATTGTCTCTGATAGAGATCCCCGCTTCACTGGCAAGTTTTGGAAGTCCATCTTCAAGGTGCTCGGCACCCGT
TTGGACATGTCCACAGCGGATCATCCGCAGACCGATGGTCATACTGAGCGTGTTGATCGCGTCATTAATGACATTTTGCGCAGTGTTTGTGCTGATACGC
CTAAGCGTTGGAGCTCCATGCTCCCTGTTGTTGAATTTGCGTTGAACAACGCTGTTCATGCCTCTACAGGCTATACTTCATTCTACGTAAACGGTCTCAC
CCACCCTCGCGTTCCGTTAACGCTACCACTATGTGGTTCAGGGCTTGATTGGGGAGAGGTTGCCGATCGGCTTGCTGATATCAGCCCTGCTACTGTTCAA
AAACAGGTAAGCGAGTTTCTCGCAACGCGATTGAATATCTTAAGACATTTTCGTGACGCAATGGCTGAAAGCCAAGACCAACAAAAACAACAAGCAGATG
CTAAAAACAGAGGTTGTATTGAACGTTATCAGGTCGGAGACCAAGTATTACTCAATGCGAAAAACCTACCTACAAATGTAGTGTCCGCTGTCTTTTAAGA
TAAAGTTGCGTCCACGCTTCATTGGACCATTTACGGTCACTGCCAAGAAGGGACTTGCATATACGCTAAACCTTCCGCGCAAATTGCGCACACACCCAGT
GTCATACGTAGGCTTACTCAAGCCATACCAGGATCCT