Description :
From Genome Similarity Track
Location :
Scaffold_1007:6633- 9879
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1007-snap-gene-0.5Lysosomal alpha-mannosidase

Sequence
3246 bases(100 bases per row)
TTGAAACAAACGCGGAAACTGCGCACTTCCATCGCTTGGAGTTCCACCTCTGTGCCTCCATTCAGAGGAGTCGAGGCCTTGCAATCATAATCCAGCTTCT
CGGGATCTTCCAATTCACTTGTCTTCCACTTTGCAGCGTATGGCTCGCGCGCTTGACTGTTGAGTGACGCAATGCCAGTCAGCAAGAGCTCCGACACGTC
ACTGATCGTAGCGTTTTGCACAGTAAACAGCTTGGAGAAGTCCACCTTCACCGGCTTTGATAAGCTCGCATGCTCCTCAACCGAGTACAAATGAGTCAGG
CGCGCCATCAGACAGTCTCTACTGAGTCGCTGAAGCGTGGTCAAGCCGACGTTTTCCGGAAAGTCAGTGACCGCCAACCATGGTACCTTTGCTCCGTCGA
CCTCAGTTTTCGACAGCTTGCGGAACGCGACGAGTGGAGCGAAGAGCTGTCTCTCCATCTTCGTACGAATACTGCGAATACCCTCAGTGGCGCTGTCAAC
ATTGATGAAGAAGTTCCCGCGGACAATCAAGCCTCGAGTTGTCTCTTTCTGGGTCAACTTATCGAAGAATGACTCGGTCTCGTTTAGGAACTCTCCGACG
CCCTTGCTGTCGTCCGCGAGCAGACGCCGATGCACCATAACCTCGATCTGACCGTCCTCCAAACTCGCAGCACCCTGCGCACGGTCCGTGACAATGTTCA
ACTGGTACTTGTCGTCTTTGATATATGCACCAGTGGTGATGGGGAAGTAATTCGCGGCGACAAACTCGGTGTCGTCGTGAAGCTTCAAGTTCCACGTGTC
TCTGTGGTTGCGCACCCGCGAGATGAACTCGAGCCCGTTCGAGTCCGTGTACAACGTCTTTGCAGACTTGATGCTCTTTTGCGAATTGAAGCGGATGATC
ACTTCTTTGCCCTTCTTGTCGCCAATCGGGATCGAACCGACTGTCCACTCGATCTCGACAAACTCGTCATCAGCGTTCACGCGATACTCCAACGTTACCC
ACTTGCCGATTTGGAAAGCGACTCGGGACGCAGTACCTCCAGATGCAGCGCCATCCACTTGAAGGTCAATGAGACGGACTTTATCAGCCTTTCCTGCAAC
TGGATGCACAGTCTTTGAGTCCGGTCGGAAGATGTACGCCCCCGAACGCTGATTGTTCTTAGCTTGGAAAGACTGGTAGTACAACACACGAGAGCTGAGC
GGTAGCTCGATGTTCTTCTTCTTGTTCGTGATAGAAATGATCGAACCCGTGTCTTTTGCGATTTTGACACGCATTAGATCGTTCTCGAGCGTTATTTTTT
CCTGAGCATCGATGTCGAGTTCCGCTGACAAAGGCTTGGGACTGTCACTCTCCCCCGCTTTCGTCTTCTTCGAAACCAAAAAGCGAGCTTCGCTTAGCGG
ATCCAGCTCCGTGCTGAACACAAGAGAGTATGGAGCCGCCATCTGATCCAGGTGTACAGGAACAGCCGCAAACACTTCGTGCTGACGCACTTTTGCAGAG
CCCGAGATTACTTGAATGTCGACATTCTTGAACACGATCGGGATCGAGATCGTCTGCACGCTCTTCCGTGCCAGCGCATTGTGAACCAGGACCTCGAATT
GCTACACAATCAAACTCAGTCAGTCATGCTCACATAACCCATCTCGTGCTGCTACAGAGTGAACCTTCATACCTCATTCGACGTAGATACATTGCAAGTG
CTGACATTTGCAAGCAGGCAAAATTCGTACTTCTCCTTCTCGCCGATCACGAAGAACACCTCATTGAGCTCCTTCTCAGCATCGAGGATACCCTCATTCA
GACGAAGCGCGTAGTCATCAGCCACAGCCTGCTTTTCGGTTCCAGAAAGACCGTCGTGATGCTGCACCAAGCCCACTGCGCGCTGAAGTTTGTCCAGCTG
TGCCGCGTGATGCGTTTGGTAGAGCGCATGAAGCTGGCGAACTTGCTGAAAGAGCGTGTTGGACACGCGTGCAAACCGCTTCAGCGCGGGGCGACTCGTG
AAAAAGCCCGACCAATACTGGTATTTGCCCGATGCGTATGGGAAGAAGTCGTCGATCTTGACGCTCCAGGTGAGGTTTTCCGCAAGCTTCAGATCCGTGT
AGTACGACAGGTTGGAGTACAACACGGAGACCCGGTTGTCTTGGTTCACATAATGCTGCAAATAAAACATCAAACATTAGAGTGGAAATATCCAGTATGC
CAAGAGTAAAAGTACGGGTTTCTGCTCATACGTACCACTAGCTTATCCATGTTCTTGTACCACCTGCGCGCGTTGTCGTACTGGAAGTCGCCGCCCATGG
GGATGAAAATGTGGTTCCCTTTCGTACTCACGCCTCGCTCATGCGCCATTCTCACAAAATCATCCACTTGCGAGCAGACGTTGAAGTCGTGCAATTCGGA
GTCATCCTGGATCTGGCGCTCTCGGTACGCAAAGTCAAACTCAAGCGGTGGACCGTAATGATTGATGATCTCGCCCGTAAACACCTGCGAGTGTTTCCCA
CGCGACTTGCTCGGTCGCCAGATGAACTCGAGGTTTTGCTTCGACTTACGCAGCGCGTAGTCCTGGTAGTCGATGCGTGCGAAGTAGAGCGCGTCGAAGC
CCACCCCCGCTGAGAGCAGCGACCCCTGCGTGGACGAGTGGCCGAAAGGGTCGATCTGCCAGCCAATGCGGGGCGTGATGTTGAACTCCTCTCTAAGTAA
ATGGTGGCCGTACGCAGTCTGGTCTACCATGGCGGTGTAATGCGGTGTCGCCTCATCGTGCATGCACCAGCCGCCGTTCACGCTCAGGTCAAGTCGACCT
TCCTTGACCAGCTGTTTCACGATCAATTTGGTCTCCGAGCTCTGCTGGTGCCACCAGCGCTGGAAGAACGACTGCACCGGCGAAATGATAGTTAGTTCGA
AGCGCTCTGTCAATCAATCAATGTATCGAGCGAGCAACATATACCTGCTCGACAAACATGAACTGGCGGTTGGGGTCCTCCAAGAGCTCCTCCACCACCG
TGTCCAACGTGTACTGCACGCGCTGCATATAGTACTGGTCGATGCTAAACAGCCATCCTCTGCACACACACACAGATACGAATATAACAAGTCAGCACAC
AACACATAGCGTTCATCCATGAGCATCGATACGTACGGATCGTCGTGCGAGTGCGCGATGAGGTGCACGTTGAGCTTGTGCGGGTCGACCTCCCCCTTGG
TGTTGTATTTGCCATCGACCGGCAGCGTCCACCTACTCGCATTGCA