Description :
From Genome Similarity Track
Location :
Scaffold_836:6629- 12620
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_836-fgenesh-gene-0.1Microtubule-associated protein EB1
Pytar_ATCC12531maker-par_contig_836-fgenesh-gene-0.05'-AMP-activated protein kinase subunit beta
Pytar_ATCC12531maker-par_contig_836-snap-gene-0.7UPF0197 transmembrane protein
Pytar_ATCC12531maker-par_contig_836-snap-gene-0.8Calpain 1, (mu/I) large subunit

Sequence
5991 bases(100 bases per row)
TCTTCGTCGACGGGTTCTGCCGACTCCTCCGCCGACTCGTCGGCCGCATAGAGGATCTCAAACAGCGCCTTGGTGACCTCGTTGGCCTCGTCCTCGGGCA
CGGTTTGCAGCGTCTCTTCAATCTGACGCAGCTTCTGGAAGTAAAAGTCGCGCTCTCGTGCAAGGCCCTCGACCTACAGAACATGATACAGACACCATGA
GCACCATATCCCCCTCTACTGCACACCCCATAGAGAGCCGTACCATGGCATTGAGCTCGCCGACTTCATTTGTGAGGCGCTCGTTGTCGTGCGTGAGATC
CAAAATCTCCTTGGCCTGCGCGAGGCTGGGCGAGTTGTTGCCGGCGGGCGCTGCGCGTGCCGAGCCACCGGCGGCGGTTCGCGAGACGGCCGTCGGTGCA
CTCGGCGGTCNNNNNNNNNNGGCTGTGCGCGTGCCCACACGGGCAGCAGCCGACGCTGTCACGGGCTTTCGCTTGGCCGCCATGGGCAGCGGCGACGTGG
CNNNNNNNNNNNNNNNNNCACCGGCACCAAACTTGGCCGTGTACTGCGCACCGCCCTTGCCCCGCTCGCGAATCGCAATCGCGTCATACGGCGCGCCGGA
CGCGTTCAGCTCGTAGAAGCGCTTGAACCACTGCATGAACTCGAGGTTGTCCTGGTACTTGCCGCGGATGAGGCGGTCCACTTCAATATGGCGGTCGATC
TTCATGGTCGTGAAGCACTTCTGGAGCACCTTGTAGTTCTGCACGTACTCGTAGTCCACCTTGGCGCTCCAGTCGACCTTGGCCATGGGCACTTTGCCGG
GGTAAATCGCGTCCAAGATCATGCACGCCACGGCGCCCGTGCACGTCTGCTCGACCTTGGTGAGGCTCGTCTGGCAGACGCCGTTGACCCAGTCGAGGAT
CTCCTTTCGGCCCACGAAGTACGTGCCGTCCATCATGGCGATGTTCTGGTCCGCGGACGCCATGGTCGCTGCGCACGGAGAGGAAAGGGCGGGAAGACGC
GGGGGATCGTCCGTGGGGGAATATTCGCTTTGGGCGCCAAGCCCTTCCAGGGATCGCAACGCAAGCGGAAAGTATACGCATCCGGATACGGAGACTGCAG
TATACAGCGTAACTCTTCTGGAGATGGGAGTGAGCGTAACCTGTATACTTGAATGGTATACGGGTTACGTTTCCAAGCATGTCGGTGGTGGTGAAAGGCA
ACAAGGCATTTTGGGAGGAAACGCGAAAATGGGCAAGAGAGGAGGCGCCGGTACGTGGTGTTTCTCGCGAACACGAGCAGGGTGTAGGCTGCTAGTAGAG
TCAGTTATATAGGCGCTGGTGCTGATGCTGGGTGAGTGCAGCGAACAGCAAGCACAAGGTGAAGAAACCGGTGCAAAAGACCAAGAAGAGCGGCCACTTC
AAGGCGCTGACCAAGCAGGAGACACGGTACGCGGCTTGCTGACAAAATGCTCAAAGGGACCGCTGGCGCCATGAATCTGATGGCTTGGTGTTGATCTTAT
AGCCAGGCCATCGTACAGACCGAGAAGAAGCAGTCATCTACTACGAAACCAACCAAGCCAAAGCGCACTGTACCCGATGAGTTTCGCAACTTCGACGAGC
GCATGGCTGCAATGCGAGTGAAGAAGCAGTCAGCACGGGCTGCACCTGTTCCCGTGAATTCGGTTGTCGCGGCACCGTCTTTCGTGATGCCCGCAGCGAC
GTTTCATTTGTGAGTGGTTGTTTCCCATTTACCAGTCTGTCATTGAATAGGAGGTATTCACCATGAACTGCTCTATTTGACAGGAATACTGCACCCCCAC
CTCAGCCAGCTCCACGGGAAGTAGAAGGCTTCCACGGCTTCTTGGCAGCGATGCAGGTGAGAACTGCTGAGTTGTTTAAGTTCTTGGGGGCGCTGATTGA
CAGGCTCTCTTCGTGCTTATTCAACAGGCATCACCGACAGCACCTCCACCTACTGCGTCACGTGAATCACGTACCCAAAAGCAGAAGACTGCAGCTCCTC
GGAATGTTTTTGCTGTGCTCGATGACGAACCGGATCCAATGTCCTCGCAGTCCACTGCACCTGCTCCAGTTCCGAGCTTCTTGCAGCCCGCGACCTTCAC
CTTCCAGACCCAAACTTCCAGCTCGTCTCTGGGAAACACTATTGCGGGGCTCACATCCCTGCAGCGGAGTCTGCTGGGCGTGACTTCCACTCCCTTCAGG
CAAGCCACAACCGAGGCGATTGACCCGGATCTGTGAAGCCATTGTTGTCGGTCTCCCTCTGTATTACGATATGGATAGTTCTGCAAAGTATAGAGGTTAT
ACAGTACGCTCATGTTGCGCGAAGGTAACATTCTGCGGTTTCCCCCAAACTCCCGCAACGGTCCCGTTGCGACTCGGGCATACAAAACCCAAGTGTGGGC
TTGAAGTGCGTCCACATCCGGAAACGCAGAGAAGGTGACAAAGGGAAGAACGGACACTAGCGCCCTCCTCATTGAGAAAGAGAGGGGAGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTCAACGTCACGGAGGGAGACCGTGCGGCGCAACACTGACGCGCAGCGTGGAGCCAGCGACC
CCTCTCGAGAAGAGTTCTCACACGCCGACGGGAAGAAAAACAGAAGAGTTGACGAGCCCCCGACTAAGTAAACACGCAGTGTATCCGCCATGGGCAGCGC
CTCGAGCAAAGACCACGACTCGAACCCGCACGATCTGGGCCAGACCATGGGCGACGGCATGGGCGGCACGGGCTCGCCGCGCGGAAGCCAGTTCCCGCTG
ACGCACCACCCGCAGTACGGCCGCGGCGGCAGCGACAGCTCGATGAGCGGCAATAACGGCGCGAGCGGCGCGTCGAAATACCACACGGGGGGCGGAGGCC
AGCGAATGTTTCCAGGCGAAGGCGGTGGAGCAGGAGGAGCAAGCGGAGGTGGCGGCGATGCGATGGAGATTGATCAGTCGGCGTCCGACCTGGACGCCGC
CGCCACGGGGCGAGCAGGCGAGACCGAAGTCAGCGCCGCGCCGGCAAACGACGTTGTGCCCATGGTGTTTCGATGGGAACACGGTGGAAGAAACGTGTAC
ATCACGGGTACGTTCAATGGCTGGTCGAAGCAGTGTCCGATGCATCGCTCGGGCAACGACTTTACGTACATTGCCAACCTCACGCGCGGTAAGCACGCGT
ATAAATTCGTGGTCGACGATGAGTGGCGGTTCGCGCCCGATCAACTCACGGTTGCCGACGTCGAAGGCAACGTCAACAACTTTGTGGACGTGTCCGACTT
CCAGTCGCTTTCGGATTTTGATTTCACGGAGACGGTGAAAGACGCCGACGAGAACCAGTACGGGCGCTTCATTCCGGACATTGACGAGTACACGAAGGAG
CCGCCGCCGCTGCCACCACACTTGCGGCACATCATTTTGAACAAGGTGGGTCGCGCGCGAGGCACTCTATGATGCCTACTACATTGTGGTGCTGATTCTG
GTGTATTCTGACCATAGAATCCCCCAAGCGTGGACACCCGATTGCTGCCTGTGCCGCAGCACGTCGCGCTGAACCATCTTTACTGCACAGCGATCAAAGA
CGGCATGATGGTGCTTGGTGTGACCCAGCGCTACAAGCAAAAGTTCGTGACCACGGTCTACTACAGCCTCATGCCTGGCACGACCTAGAGTGACCAAAAC
GCGGACGTTCGCGATTTGGTCTCGTTTTTCGCGTCCTCAATCTTCGGTTCCAATGTTGCCGTCCAGTTACTTCAATACCTCAAGCTCTCTCAATCGGAAG
TCCCACCCCACTTTCAGCGTACGTGTAACAAGCCTCCTCGTAGGAAGAGACCATTGACCACTCGACAGACCGAGAGAGCTTTCAAGCACACTGGAGGACA
AGCCTGGCCCCACAGGATCACTTGCACGAACGATCGTCCGGGCATTTCGAACGGTATATCAGTAGAGACTCGGTCGTGTTGTAAATAGTCAAATACAGAG
GCTGCATTTTCCAAAGAGAACAAAGGTCAAACGAGCGGTGGAGGGGCAGAAGCATTAATGCACAACCAGGCGAATGACTCAGGAAGAAATCGATTGCATT
CCCATCAATATTACGAGAAGACTTCCAGGCGAGAGCCGTGGATATGCGGGCTGAAGTACATGTCGAAAGATATCTGCCCAGTGTTTAAACGTAGATCTCG
GCCCAGAGAAAGAGGAAGAGCGAGCCAAAGCCCAGCAAGAACGCCGCGACGATCGCGAGGAGAAGCTCGACGAAGAAGTTCTTCTTGGGCGCGACGGCCT
TGGTGAAAAAGACCGACATGACGGTGAGGCCCGAGAGCAGCAGCGCGACTGTCAGCGTGCCATAGTGGTCCGGGTTCACGGGACTGGTGTATGGGATGTC
CTGCGCATCAAGTGCATCTTATTAGAGACCCCCTAGATTCCATACTCTCAAAGGGAAGCTCGCGCGCAGGAGACGTACCATTGCGATCGGGCTTGTATCT
CTTCGATCCAGGATTCACGTGTCAACGTTTCCTGCCTCCTTGCTATGATCACCTTCGAACAATATTGTAATGTCTGGTGCAGTACCCAATCTGAGGAGAA
TCAGACTCAGGTGAATTATATCCGATACGACATGGCGTCAACTTCTTAGGAGAGGATGAAGCACTTCGTGGTTGTGGATTGCACCTAGTTATTATTCATC
GGCCTCGTCGAGCGCCTCTTCGAGGCGTTTAATAAGGTTGGCCTTGAGGCCTTTGGTGTCGAGCCCTCGCTTTTTGAGCTCGTCGCGTAGCTCCGTCACG
CGTAACTTGGCCACATTGATTTTCTGATTTTGAGGGGTCGTGAACGCCGTTGCCGTGGCCTCCTCTGCCGGTGCGGATCCTGTTGGTGTTGCCTGCTCTG
TTGCCGCTTGTNNNNNNNNNNTGTTGCCGTGGTCTCCTCTGCCGTTGCGGATCCTGTTGGTGCTGCCTGCTCTGTTGCCGCTTGTGTTTTCGAAGGAGAA
ATAGCTGGAGGTGGGGAAGGCGATTCCATCGTGATATCGGCAGCAGTCTTCGGATCCAGTGAAGGAGTAGCTTCCTGCTTGACCGGCTCAACTCGCGCGG
GGCTGATCAACTCCTCCTTAACGTGCAGTTCGGAAGTTACCGCCGTTGGCGTTGGAGTCGATGGATGAGCGACAGCAGTTTCTGTGGGCAGAACCTCTTG
CTTCACGGGCCGAGGAGGTGACCTTAGGTCTTGCGTGGTGTCGACAGCTTCACTCTCACTATTCGCCATTGCATCACCGTTCTCTTCATTTCGGATAGTC
GTGTCGTTATCCACGGCGTTCGTGTCTTCCGACATAGCAGCGTCGCCGTCACTGTCAGTGGGTTTGCTTTCCGCTGACTTCACCTTGTCGGCCTCTTCTT
TCTTCACGGCTTCTTCTTCAGCAGCATGCTGTTGCTTTGCGTCTTCGAGCTGGGTCTTCAGGTCGGCTATCTTTGCAGTGTACTCGACCTCGATTTCTTG
CAGCCTGCTCTCACACTCGCGCGCTTTCACACGGAGTTTCTCCTCAGAAGCCTCCACCGACGCAGCGACGAGATCCTCCGTCTCCTTGGTGTGTTTCTTC
GGCAGGTAATAGAGAGGAGGGGAGGTCACCGTCAGCAGAAACTGAGCCAGCGATGATGTCTTTCGCGATTCCTGGACATGCTTGAGCTTGGTGCGAGTGA
GTTCTTCCTTCATATCCACTTCTGTCGTTGCGATCAGACTCTCGAGCTTGCCCACAGCCGCAGTGTACTTTGCCTTGACTTCTAGTGCACGGCTCTGTTC
CTTTTCTTTCTGCTCGGCCTCGAGCTGCTTGGACGTTTGTCGCTTGATTAGGCTGCTGTCCTTTTCGATCATCGCCTTGGCCTTGCCAAGATGGCCCATA
AGTGCACCAAACATGCGTCGGCTTCGTGCGAGGCCGTCTTTCTGTGAGTAGGTCGCGACTGCACGGCGCTTGTCTCGATCGCTAATAGGGA