Description :
From Genome Similarity Track
Location :
Scaffold_1:662895- 663932
Transcript NameFunction/comments
Physo_468222Hypothetical protein
Physo_472142Hypothetical protein

Sequence
1037 bases(100 bases per row)
GTCGAGAGGTTGCTCTTGAAGCCATTGGGGCGAGCGGTGGTATGCGCGCTTCTCGCAAGAGCATGTCCAGTGAGCTTGATCCTTGAGTTGGTCCGCCAGC
ATATCGACTCTGTCCATAGCTGTGGCTAGATCGGCAACTATGTTGTAGCGTTTCTGCAAGTCAAGGCCTTCCTTATAATGGTTCATGAGGGTGTCGTGTG
GTGTGGAAGGGTCCGCCTCCATCGCGATAAAGCGCTCGATATGTTCGTCTTGCTCCTCGCGATACCGCAACAAGTTGGAGTTTATACATTTTAGACGTGC
CCGAATTTGCGGTCGCGTGATCTACATTTTCATATCGAATACAAACATAGATATCATTACCCGTAACCAGCCACGATACACATTTTGGCTTACCTCAGAC
AGCTCCATGCACGTCTCCTGCCAACGCATCATCCAGATAAAGTTGTGCGCACGGTCATCTTCACCGCGACAAATCGCCACGTAGAGGTCGTTCATCTCTT
TCACTGGCAGTGCAATTATGAAGTCGTCTATGTCGATCGACGTGCCACATCTCGCTTCGGTTCTCTACAGGTAGGCACTGATTAGCTTTAGCCAAACGTT
ATTGCGTAGCTACACGAACTTACCCGCTCTCGCCCAGAAGGGGTCACAAATACTGGATACAGATTGTCGAACTCCAGTTGCTCACCGGCGCTACACAAAG
CCAAAGACTATATATGCGATGAGCATCAGCACGGCCGAAACAATGTCATCACTACCATTTCAAGCGTCTTGGACGATCCGTAAATTCGCCTTCCATCGCT
TGCATGCGTCTTCGTTGGTCCTGGCAACTACCCATACATAGCCGTTCGTATTAGCACTAGCATAACAACACGATGCCGAAACAGCCAAAACACGTACCTC
TACATTACCCGCGTCCTTCCTGCGATCAACCATCTTTCCACTTGAGCGCAGAATCTAGAATGATGAAGTACTAGAGATCAGCGTTGTTGGGTGGATATGA
TGGACCGAATATATTGTTATTTGTATGACCATGTTCG