Description :
From Genome Similarity Track
Location :
Scaffold_379:66274- 69416
Transcript NameFunction/comments
Aphin_H310_07003Hypothetical protein
Aphin_H310_07004Hypothetical protein
Aphin_H310_07005branchpoint-bridging protein, putative

Sequence
3142 bases(100 bases per row)
CCAGATCGCGAACTCGCTTTCGTCCATCCGTCTTGTCGTCGATAAAATTCGCCAGGCGTTTGGGGTACACTAGCAGCCTCTTTGACTCGCCCCCAGCTAA
CAATGAGTCCATCCGTTGCCTAGGAAGCAAAAGCGGCGGGGGAGATATACTTTAACTTCGCACTCAACTTTGTCGCGTCCAAGATGGCGGCCCAAGTCCG
CGTGTTGGCCGAAGTCAGGTACATACCACATACGATGAGTGCCATTTCTTGACTGGCGCTGGCTGGGCAGCTCGTGCTTTCCCATCGCCAACGTCGTGGC
CATGTGCTGTGTCCACACACCCGAGTTGACCGATATCTTCTTGGCCCACATGCACACGGTACCATTTTCACCGCGTCGACCGATGCGCAAGTCCAGTAAG
GACTGCTTTGGCGTAGATATGCCCGTACACGATTCCTCTCGTGCCCGTGCGAACGGAAGGCCAAACGGACGACGAATATCGAGTGTCGATTGGCATGGAG
CGCGACGAGGCCAAAGGAACGTTTGAAGCGTTTGAAAAATACACACAACGCATGGCGATGGCCGTCGCCTTGGTCATGGCTGTCATGCAGGTACGTCGAT
CGATCGCATGTTTCAACGTATGCTCACGCAACATGGTAGACCCACCCGTATGACCGCCAGCCCCAGTCAACACACCTGACCATTGCAGACGCGTGGAGGT
GGATGGCGCGGGTCGTGAACTCGGCGCCACATGCGATGACGGCCCCCGTCTTGCTCTCTGCTTTCGAGGTAGCGCTTTTTCAGATACGTCCATCGCACTG
AGCAAATTCCCTGAGGTCGCCGGGTTCGAGTTGCATCGCCAATACAAGTCGCAGTTTCTCAAGCTCGCAAGTGTCGTTGAGTCGGCAGTCGTGCCCATCC
TGAGTCGGGTACGTTCAGCATTATGTTGATTCTTGAGCTGATCGATGGCTCGCCAGGACGTGAAAAGCGGCGGGGCGGCCACTTTAGCTCGGTTGACTAC
AATCCTCACCCAACGCGGGTTTCAAATTGAGCCGGAAGGGCGAAATCCCACCGAATCCAAGGTCACCGAAGCAGATGAAGAAAAGACCGCCAACGATGAC
GTCTCGCCCGGGTACGGGTCGTCGCGGTATAGCAACAATTATTCGGGCGGCGGTGGCCGTGGACGCGGCAGAGGTCGAGGAAGTTATCGCTGACGGAATG
GGACCACGTCGCGCCTTTATTTGAGAATTCTTTATTCGGTGGCAAACTTTGCCACGAGTTGCTGGAGTTGCTCTGCTCGCGCGAGTTCCGACTTGACGTT
GTTCCCAATGAACCACACAGTCATGGCCGCACACACATAGTACACGGCGCACAACGGAATGGAGTTTCGGATGAAAGTAGAGGCGACGCCGTACACACGC
AATAGCAACCACATCCCCGTGTGGACAACGCACAGAGAAAAGCACAATGAGTGCCCTGTACCAGTCGCCAAGACGAGCTCCTTGACAGAGTAGATGGCAG
CACATGACACCAGCTTCATCAAGACAAGCACAGCAAGGACACCTGCGGTCTCCGCGGTGTTCGACGCCACCGTCGTCAACAGCACATACAGCTCGTACAC
GGCCAACATATACGCCAAGGCGGCAATCATTTGCTACACGAACTGTACATGAATCGCTGCCACTCGTTCACTGATCGGCCCTACCTTCCAGAATTGGTTG
AACGCATCCACGTTGTCCTGCGACTGGCGCAGGTGATCTGTGCGTCCCCACACTACAGTTAGATGCAAAAGCCTGGACGGAATGCAGTTTACCGCTCAAG
GGCGACGTCGAGGTGTAGCTGGATGTCTCCACGTCGAACGCGTCGTCGTGGGTAATGCCCGCGAAGCGGCGTTTGCGACTCCGAAGTCCCATGGCAAAAC
TTTCAAATTTGAAATCGCTTTCTAATACAACGTTTTAGTAGTCGCGTTCGAATAGTACTACTACACCGCAAATTCGAATAAATCAGTCTGTGAAAATTAA
TAAACTCGTCTTGATCGCAAGATTCTCGAATTTTGTTGTTGGCCAAGGACGCGCGGTGGAGCTCGCCGCGATGGAAAACGATCCATATGCACAAGAAGAA
GAGATGGAGCGTGAAGCCCTCATGCGTGCGTCCTTCCAGCCCATGAAAAAGTGGTATGCCGACCACCCCGAACATTCTGAGACGTATGGACCGTTCCCGT
TGTTTTGGCAAGATTTGAAGACGTGGGGTCCTCATCGCGACGTTCAACGCTTGTTTCTCAAAGCTACCGAAACGGCCAGTGACAGTCAGAAGGCGAGCCC
CGAAGACGGTGGTGATAGTGGTGCCAAGCCTGAGCAACCCATTGAGGAAGATGCAGCAGCCAAGGGAAAACGTCGTCGGAAAAGCAAATGGGATCAGGAC
GGCGATGAACCATCAAATGAAACCCCCACGACCATAAATGCGACGGCACCTGCGCGAAAGAGTCGCTGGGGCGCTGCCGTGGAGTCGAACGAAACAGAAG
AAGCACCTCCAGCAGCCCCCAAGAAGAAGAGCCGATGGGCGCCAGTCGGATCGTCAGCCGATGGACCAGCAGTAATGTCCGCTGCCGAACAGCAATCGAT
CGTGTTGCGGGCAAAGCTAGATGCTCTTGCGTTGAAAATGGCGACAGTGGTGCAGGACGCTGCGATTATATCCAAGGATCCGAATCGATCTCCGTCACCT
CCCCCAGTCTACGACTCGATGGGGAAGAAGCTGAACACGAGAGAGGCGCGCATGCGCGCGGCATACGAAAGCCAGCGCATGGATATCATCGGTCAGTTGG
TCCAGGTGAACCCGCTTTTCAAGCCACCGCCAGAGTACTTGCGCGCGCGGCTGCAGCGGAAGCTCCCAATTCCGCACAAGGAGTACCCCACTTATAACTT
CATTGGGCTTATCATTGGACCGCGCGGGAACACTCAAAAGCGCATGGAAAAGGAATTCAATTGCCGCATCGCGATTCGAGGACGGGGAAGCGTCAAAGAA
GGCTCCAAGGGCAAGAAAATGATGTCGGACGACCACGAAGAGCTCCATGTCCTGATCACAGGCGACCGCGAAGAAGACATTGAGCGTGCAGCAAAGGAAG
TGGCCCGTTTGTTGGAGCCCATTGATGACACGAACAATGCCC